Вагин игорь википедия: Биография Игоря Вагина – творчество и личная жизнь автора, читайте на ЛитРес

Автор: | 16.04.2021


200 богатейших бизнесменов России — 2013 | Рейтинги

1 +8 Алишер Усманов

USM Holdings

17600 +5000
2 +5 Михаил Фридман


16500 +1500
3 -2 Леонид Михельсон

Новатэк, Сибур

15400 -8600
4 +7 Виктор Вексельберг


15100 +3600
5 -2 Вагит Алекперов


14800 -5900
6 +2 Андрей Мельниченко

Еврохим, СУЭК

14400 +600
7 -1 Владимир Потанин


14300 -3800
8 -6 Владимир Лисин

НЛМК, UCL Holding

14100 -7200
9 -4 Геннадий Тимченко

Volga Resources

14100 -6000
10 +2 Михаил Прохоров

Группа Онэксим

13000 +3200
11 -7 Алексей Мордашов и семья

Северсталь, Nord Gold, Силовые машины

12800 -7700
12 +1 Герман Хан


10500 +800
13 -3 Роман Абрамович

Millhouse Capital

10200 -2200
14 +3 Дмитрий Рыболовлев


9100 +2300
15 +3 Искандер Махмудов

УГМК, Кузбассразрезуголь, Трансмашхолдинг

8700 +2100
16 +14 Олег Дерипаска

Базовый элемент

8500 +4900
17 +15 Сергей Галицкий


8200 +4700
18 -2 Алексей Кузьмичев


19 +3 Андрей Скоч и семья

USM Holdings

7900 +2700
20 -1 Сулейман Керимов и семья


7100 +800
21 -6 Леонид Федун и семья

Лукойл, ИФД КапиталЪ

7100 -1600
22 new Филарет Гальчев

Евроцемент груп, Уралкалий

6700 new
23 +40 Владимир Евтушенков

АФК Система

6700 +5200
24 -1 Сергей Попов

МДМ Банк

5800 +1300
25 -4 Петр Авен


5400 +200
26 -6 Александр Абрамов

Evraz Plc

4600 -1600
27 -13 Виктор Рашников


4200 -4700
28 -2 Андрей Гурьев и семья


4000 -300
29 = Самвел Карапетян


3800 +100
30 +21 Александр Несис

Группа ИСТ

3300 +1300
31 +10 Аркадий Ротенберг

Мостотрест, Стройгазмонтаж

3300 +700
32 +26 Владимир Богданов


3200 +1600
33 new Дмитрий Мазепин


3200 new
34 -6 Михаил Гуцериев


3000 -700
35 -2 Зарах Илиев

Киевская площадь

3000 -500
36 +68 Лев Кветной

Новоросцемент, Аэропорт Внуково

3000 +2050
37 -3 Год Нисанов

Киевская площадь

3000 -500
38 +19 Василий Анисимов


2900 +1300
39 +4 Александр Светаков

Группа Абсолют

2800 +300
40 new Николай Цветков


2600 new
41 new Зияд Манасир


2500 new
42 -15 Вячеслав Кантор


2400 -1400
43 new Данил Хачатуров


2400 new
44 +52 Александр Джапаридзе

Eurasia Drilling

2300 +1300
45 -3 Александр Мамут


2300 -200
46 new Виктор Нусенкис


2200 new
47 -1 Дмитрий Пумпянский


2200 =
48 -3 Вадим Мошкович

Русагро, Авгур Эстейт

2100 -200
49 -13 Александр Пономаренко


2100 -1100
50 -13 Александр Скоробогатько


2100 -1100
51 -16 Игорь Кесаев

Группа Меркурий

2000 -1200
52 -12 Александр Фролов

Evraz Plc

2000 -700
53 new Андрей Клямко


1900 new
54 -6 Игорь Макаров


1900 -200
55 +31 Глеб Фетисов


1900 +700
56 -4 Араз Агаларов

Группа Крокус

1800 -100
57 new Михаил Балакин


1800 new
58 new Игорь Зюзин


1800 new
59 new Валерий Коган

Аэропорт Домодедово

1750 new
60 new Рустам Тарико

Русский стандарт

1750 new
61 new Алексей Ананьев


1700 new
62 +103 Дмитрий Ананьев


1700 +1100
63 +52 Анатолий Седых


1700 +800
64 +52 Анатолий Скуров

Сибуглемет, Уралкалий

1700 +800
65 +42 Андрей Молчанов

Группа ЛСР

1650 +700
66 +115 Владимир Гридин

Сибирский деловой союз

1500 +950
67 +9 Андрей Косогов


1500 +200
68 new Зелимхан Муцоев

Уралкалий, Группа Регионы

1500 new
69 -8 Роман Авдеев

Московский кредитный банк

1400 -100
70 -3 Фархад Ахмедов


1400 =
71 +11 Олег Бойко


1400 +200
72 +5 Мегдет Рахимкулов


1400 +100
73 +19 Борис Ротенберг

Стройгазмонтаж, СМП Банк

1400 +300
74 -12 Андрей Бокарев

Кузбассразрезуголь, Трансгрупп

1350 -150
75 +8 Никита Мишин


1350 +150
76 +8 Константин Николаев


1350 +150
77 +121 Александр Путилов

Eurasia Drilling

1350 +850
78 +56 Николай Саркисов


1350 +550
79 +56 Сергей Саркисов


1350 +550
80 +13 Андрей Филатов


1350 +250
81 -27 Валентин Гапонцев

IPG Photonics

1300 -500
82 new Максим Ноготков


1300 new
83 +81 Михаил Абызов


1250 +650
84 new Сергей Кислов

Юг Руси

1250 new
85 -60 Игорь Алтушкин

Русская медная компания

1250 -3050
86 new Константин Григоришин

Энергетический стандарт

1200 new
87 +30 Юрий Гущин

Группа Гута

1200 +350
88 -64 Андрей Козицын


1200 -3200
89 -20 Петр Кондрашев


1200 -200
90 -20 Анатолий Ломакин


1200 -200
91 +51 Николай Максимов


1200 +450
92 +81 Михаил Федяев

Сибирский деловой союз

1200 +600
93 -27 Гаврил Юшваев


1200 -300
94 -26 Аркадий Волож


1150 -250
95 -30 Леонид Симановский


1150 -350
96 -11 Рустем Сультеев


1150 -50
97 -9 Альберт Шигабутдинов


1150 -50
98 -17 Елена Батурина


1100 -100
99 -25 Юрий Ковальчук

Банк Россия

1100 -200
100 new Дмитрий Коржев


1100 new
101 +18 Александр Луценко и семья


1100 +250
102 -71 Юрий Мильнер

DST Global

1100 -2500
103 new Дмитрий Троицкий


1100 new
104 -25 Айрат Шаймиев


1100 -200
105 -25 Радик Шаймиев


1100 -200
106 new Владимир Щербаков


1100 new
107 +42 Владимир Груздев


1000 +300
108 -70 Дмитрий Каменщик

Аэропорт Домодедово

1000 -1800
109 -22 Виктор Харитонин


1000 -200
110 new Сергей Цикалюк


1000 new
111 +29 Владимир Коган


950 +200
112 new Марк Курцер

MD Medical Group

950 new
113 new Владимир Махлай


950 new
114 +7 Вячеслав Мирилашвили


950 +100
115 -24 Андрей Раппопорт


950 -150
116 new Алексей Семин


950 new
117 -58 Роман Троценко

АЕОН Корпорейшн

950 -650
118 +27 Давид Якобашвили


950 +200
119 +74 Андрей Кузяев


900 +400
120 new Борис Минц

O1 Properties, ФК Открытие

900 new
121 +3 Александр Тынкован

М. Видео

900 +50
122 -20 Дмитрий Босов


850 -100
123 new Яков Голдовский

Petrochemical Holding

850 new
124 +61 Зиявудин Магомедов

Сумма Капитал

850 +300
125 +35 Виталий Малкин


850 +200
126 -73 Константин Струков


850 -1050
127 -83 Андрей Андреев (Оганджанянц)


800 -1500
128 -2 Григорий Березкин

Группа ЕСН

800 =
129 -2 Андрей Бородин


800 =
130 +36 Вячеслав Брешт


800 +200
131 new Борис Волчек


800 new
132 +18 Давид Давидович


800 +100
133 new Вячеслав Заренков


800 new
134 -62 Евгений Касперский

Лаборатория Касперского

800 -500
135 new Рустем Терегулов

Большой город

800 new
136 new Георгий Генс


750 new
137 new Тельман Исмаилов

Группа АСТ

750 new
138 -8 Андрей Комаров

Группа ЧТПЗ

750 -50
139 +4 Николай Ольшанский


750 =
140 -26 Сергей Петров


750 -150
141 +3 Андрей Рогачев


750 =
142 new Микаил Шишханов

Бинбанк, Интеко

750 new
143 +3 Альберт Авдолян


700 =
144 +3 Сергей Адоньев


700 =
145 +34 Александр Вагин


700 +150
146 -41 Геннадий Козовой


700 -250
147 +48 Михаил Куснирович

Bosco di Ciliegi

700 +200
148 new Александр Ракшин


700 new
149 new Серик Рахметов


700 new
150 -52 Захар Смушкин

Группа Илим, Старт Девелопмент

700 -300
151 -104 Олег Тиньков


700 -1500
152 new Александр Щукин

Шахта Полосухинская

700 new
153 new Виталий Юсуфов

Nordic Yards

700 new
154 new Сергей Глинка


650 new
155 +34 Саит-Салам Гуцериев


650 +150
156 new Арсен Каноков


650 new
157 new Максим Ликсутов


650 new
158 +20 Николай Борцов


600 +50
159 -1 Олег Бурлаков


600 -50
160 +20 Александр Гирда


600 +50
161 new Андрей Кобзарь


600 new
162 new Владимир Костылев

СК Мост

600 new
163 -57 Игорь Кудряшкин


600 -350
164 new Александр Лебедев

Национальная резервная корпорация

600 new
165 +4 Олег Леонов


600 =
166 -46 Кирилл Миновалов

Банк Авангард, Авангард-Агро

600 -250
167 new Дмитрий Николаев


600 new
168 new Михаил Слипенчук

Группа Метрополь

600 new
169 new Александр Смузиков


600 new
170 -62 Дмитрий Стрежнев


600 -350
171 new Евгений Сур

СК Мост

600 new
172 -63 Эдуард Чухлебов


600 -350
173 new Виталий Южилин


600 new
174 -38 Игорь Яковлев


600 -200
175 -75 Вадим Якунин


600 -400
176 = Вячеслав Аминов


550 =
177 -39 Алексей Богачев


550 -200
178 new Алексей Гудайтис

Группа ИСТ

550 new
179 +3 Андрей Добров


550 =
180 -83 Борис Зингаревич

Группа Илим, Ilim Timber

550 -450
181 new Илья Зубарев


550 new
182 +1 Петр Колбин


550 =
183 new Дмитрий Никитин


550 new
184 -13 Михаил Николаев


550 -50
185 new Игорь Рудинский

СИА Интернейшнл

550 new
186 -11 Игорь Худокормов


550 -50
187 -1 Вадим Аминов


500 =
188 new Григорий Аникеев

АБИ Продукт

500 new
189 new Андрей Бесхмельницкий


500 new
190 -89 Андрей Блох


500 -450
191 -96 Леонид Богуславский


500 -500
192 new Валентин Бухтояров


500 new
193 -90 Рубен Варданян


500 -450
194 -27 Сергей Генералов

Промышленные инвесторы

500 -100
195 new Николай Грешилов

Корпорация Гринн

500 new
196 new Николай Добринов

Группа ИСТ

500 new
197 -85 Владимир Литвиненко


500 -400
198 -1 Владимир Мельниченко


500 =
199 new Григорий Ройтберг


500 new
200 new Иван Таврин

ЮТВ Холдинг, Мегафон

500 new

Участница:Юлиана Пучкова/Кто психолог, а кто нет? Википедия

Для начала из списка психологов в Википедии выписываем сюда тех, статья о ком нуждается в уточнении — на каких основаниях каждая персона отнесена к категории Психологи России или Психологи по алфавиту, и даже на каких основаниях человек вообще именован психологом.

Иногда в статье просто не хватает конкретной информации или АИ для обоснования этого (ссылок на научные публикации, например).

Часто к психологам относят врачей-психотерапевтов, что также является ошибкой. Для них больше подходит категория Психотерапевты (или подобная), а смешивать их с психологами значит вводить читателей Википедии в заблуждение. Ведь психологи не претендуют на включение в медицинские категории.

Авторство книг по психологии также не может быть основанием для отнесения персоналии к психологам (ведь поименование автора психологом в таком случае — это ответственность издательства, имеющая коммерческий смысл). Значимость и категоризация таких персоналий тогда должны основываться на их писательской (или иной) деятельности (тиражи, например).

Следует учесть, что для деятелей прошлого (например, Фрейда) критерии должны быть другими. Указываем только отечественные персоналии, так как для иностранных разобраться в этом вопросе еще сложнее, но нет и засилья квазипсихологов.

По мере сил давайте править статьи, ставить запросы на АИ и так далее.

Добавляйте информацию непосредственно к позициям в списке. Добавляйте новые статьи, если их нет в списке (новые — внизу, я потом ставлю по алфавиту).

В категории «Психологи по алфавиту»: а также в категории «Психологи России»:

— Агапова, Ирина Анатольевна

— Астафьев, Пётр Евгеньевич — вероятно, был неплохой философ, но собственно в психологию его вклад неясен

— Бахтияров,_Олег_Георгиевич

— Блюмина, Тамара Александровна

— Бурделов, Николай Павлович

— Вагин,_Игорь_Олегович — статью удалили, т.к. не доказана значимость персоналии. Обсуждение удаления: Википедия:К удалению/23 сентября 2009. На случай, если статью захотят восстановить с доработкой, оставляю персоналию в этом списке. 18 марта 2010 статью восстановили. И благополучно удалили Википедия:К удалению/2 апреля 2010#Вагин, Игорь Олегович

— Васильев,_Леонид_Леонидович (ученый первой половины ХХ века, желательно дополнить информацию о связи его исследований с психологией, а не только с физиологической стороной изучаемых им процессов).

— Гарифуллин, Рамиль Рамзиевич (дополнено: специальность «психология» в КГУ)

— Егидес, Аркадий Петрович (нет информации о его докторской диссертации по психологии, о научных трудах в указанной области научных интересов, только названия популярных изданий)

— Заморев, Сергей Иванович (нет информации о его кандидатской диссертации по психологии, неясная (отсутствует?) значимость в качестве психолога — тогда какие основания для включения в психологические категории?)

— Зеличенко, Александр Исаакович (неясно, какое образование имеет в сфере психологии)

— Кирнарская, Дина Константиновна (хорошо бы развернуть информацию о ее интереснейшей деятельности в сфере психологии — о чем докторская и т.д.)

— Леви,_Владимир_Львович (врач-психотерапевт, автор книг по психологии — а почему психолог, непонятно)

— Литвак, Михаил Ефимович (врач, автор книг по психологии — почему психолог, непонятно)

— Мазин, Виктор Аронович (добавлена нужная информация, нужно внимательно выверить и отпатрулировать)

— Мусхелишвили, Николай Львович (религиовед, член маргинальной РАЕН, о психологической деятельности не хватает информации)

— Овчаренко, Виктор Иванович (философ) (философ, член маргинальной РАЕН, нет психологического образования, диссертации по др.дисциплинам)

— Осорина, Мария Владимировна — неплохого было бы расписать значимость (а она точно есть), иначе — на удаление.

— Переслегина, Елена Борисовна (в таком виде может быть выставлена на удаление: не показана значимость ни в качестве ученого, ни в качестве автора книг)

— Покрасс, Михаил Львович — врач-психотерапевт.

— Попов, Николай Михайлович — психиатр.

— Свияш, Александр Григорьевич (выставлялась на удаление дважды, дважды была оставлена с условием существенной доработки — пока тишина)

— Семёнов, Сергей Петрович

— Сосланд, Александр Иосифович — психотерапевт.

— Суворов, Александр Васильевич (психолог) — значимость?

— Хасан, Борис Иосифович — изолированная статья, нет ссылок, публикаций, отсюда вопрос по значимости.

— Шишова, Татьяна Львовна

— Щербатых, Юрий Викторович

Игорь Стоянов. 60 правдивых историй

Игорь Стоянов

Владелец сети салонов «Персона Lab»

«Маркетолог – враг любого дела»

ТЕКСТ: Антон Бильжо

ФОТО: Александр Басалаев

В 1992 году в кафе «Марика» сидели 11 довольных жизнью и невероятно богатых молодых людей. Торговцы «Сникерсами», челноки, владельцы подпольных цехов по пошиву джинсов. Сегодня двоих из них нет в живых, у восьми от тех времен нет ничего, кроме сладких воспоминаний. Самым дальновидным из всех оказался одиннадцатый – вдумчивый и немногословный. Все очень удивились, когда Игорь Стоянов решил открыть парикмахерскую. Кто бы мог подумать в 1992 году, что можно создать бизнес с пятимиллионным оборотом, продавая атмосферу.


– Женщину, у которой все в жизни не так, видно сразу,– говорит Михаил Ранцев, администратор одного из салонов «Персона Lab».– У нее некрашеная голова или отросшие корни. От нас такая женщина выходит совершенно другим человеком.

Михаил стоит за маленькой сквозной стойкой в небольшой комнате, которую видно со стороны 4-й Тверской-Ямской улицы через витрину. За стеклом -зеркала, кресла и яркие ребята в джемперах и джинсах. Они угощают друг друга конфетами, шутят, смеются – в общем, живут своей жизнью. В соседней комнате мягкие полосатые кресла, венецианская штукатурка, в стены вмонтированы телевизоры. Показывают, конечно же, канал Fashion.– Я даже дома не могу сидеть, меня сюда тянет,– рассказывает топ-стилист Ольга Зайцева.– Здесь ощущение праздника. Все такое яркое, современное. В углу зала с мягкими креслами девушка-визажист оживленно беседует с клиенткой. Кажется, они давние подруги: слышен то шепот, то хохоток.


– В 1993 году я стригся у своего приятеля и спросил, сколько стоит открыть парикмахерский салон,– говорит Игорь Стоянов, расстегивая мощными руками пуговицы полупальто от Yohji Yamamoto полувоенного кроя. – Почему-то мне казалось, он должен знать. Это теперь я понимаю, что парикмахерам не стоит задавать таких вопросов: обязательно что-нибудь перепутают. Он ответил: ну, тысяч тридцать. У меня была примерно эта сумма. Когда отступать уже было поздно, выяснилось, что я попал на 200 тысяч. Приходилось занимать и долго и трудно расплачиваться.

Откуда взял первые 30 тысяч, Игорь рассказывать не хочет. Говорит, что это было время шальных заработков. Фирма «Маяк» в подмосковном Чехове делала проблесковые маячки.

– Чудом я там не застрял. Грязная, серая, тяжелая криминальная Москва.

Это время надо было просто пережить. К 1993 году Стоянов уже успел поучиться в Московском государственном педагогическом институте имени Ленина, расстаться с мечтой о создании собственной школы и дослужиться до младшего сержанта в погранвойсках. – За год я перескочил ефрейтора. Был лучшим стрелком. Неплохо бегал. Я построил там первый тренажерный зал, добился, чтобы на вышке стулья поставили, потому что у ребят варикозное расширение вен было, для солдат Новый год сделал… Наверное, я перфекционист. Каждый отрезок жизни стараюсь прожить с удовольствием.

В первый состав «Персоны» Стоянову удалось привлечь людей, имена которых благодаря международным конкурсам были широко известны. У него работали Наталья Власова, Александр Шевчук, Ольга Бурмистрова и другие.

– Я сразу прикинул, что может делать парикмахер. Стричь, преподавать, работать на телевидении. Мы открыли парикмахерскую, школу, имидж-агентство. На этих трех китах и стали развиваться. В школе выращивали кадры. Благодаря имидж-агентству познакомились с телевизионными и журнальными людьми. Смогли себя рекламировать.

– И вы легко погрузились в мир моды после армии и пединститута?

– Мы в него не погружались, мы его создавали. Отдельно от всех, от всей этой нарождающейся индустрии. Каждый салон я собирал по крупицам. То, как выглядят мои салоны, какая в них мебель, какие стены, пол и потолки,– все это придумано мной. Главное – атмосфера.

Остается загадкой, как сын рабочего машиностроительного завода из города Тольятти смог один за другим создавать интерьеры, куда тянуло московских модников, как угадывал тенденции, подбирал зеркала к стульям, стулья к столам, столы к стенам. Сам Игорь говорит, что дело во внимании и наблюдательности.

1998 год «Персона» пережила без больших потерь тоже благодаря его интуиции. Салоны «Персона-Lab», в которых постричься было дешевле, чем в основной «Персоне», появились за несколько месяцев до кризиса. Всего через год у них было 3 тысячи постоянных клиентов.

Сегодня 20 салонов «Персона-Lab» – это около 5% бьюти-рынка, на котором брэнд «Персона» считается самым сформированным.

Главным минусом компании маркетологи считают то, что она слишком завязана на своего владельца. Но сам Стоянов называет маркетологов врагами любого дела и к их расчетам относится скептически. Говорит, что идеальных рецептов не существует. Лучше всего работает эффект неожиданности.

– Три года назад мы выпустили первую пластинку «Персона лайф-стайл». Потому что я понимал: это атмосфера, которую ты можешь забрать домой после стрижки. Это хорошее воспоминание. И это работало.


Однажды устраиваться в «Персону» пришла девушка, которой предстояло делать клиентам химическую завивку и красить им волосы. Игорь заметил, что сама она не красится.

– А почему? – спросил он.

– Ну, мне кажется, это вредно.

– Как же вы собираетесь красить людей. Вы что, готовы их обманывать и чувствовать, что обманываете? И потом, неужели вы считаете себя умнее миллионов женщин всего мира, которые красят волосы? Значит, наверное, где-то вы не правы. Значит, можно красить волосы по-разному.

– Наверное,– задумчиво сказала девушка.– Наверное.

– Вот видите. Вот когда узнаете, как красить волосы правильно, тогда и приходите ко мне,– отрезал Стоянов.

Он говорит, что основой его дела является компромисс, который приходится постоянно искать. С бандитами, по его словам, «Персона» не пересекалась, а вот с пожарными и СЭС Игорь нашел компромисс легко.

– Постепенно понимаешь, что их требования – это наше качество обслуживания. Вне зависимости от всех этих комиссий огнетушители и бактерицидные лампы нужны, и мы их устанавливаем.

По-настоящему сложно, говорит Стоянов, найти компромисс между посетителями и сотрудниками.

Администраторы «Персоны» проходят психологический тренинг. Они знают слабые и сильные стороны своих парикмахеров, знают, у кого какое настроение, и могут точно определить, какого клиента к какому мастеру направить. Более того, в кадровой службе есть люди, которые отвечают за то, чтобы в каждом салоне подбирался совместимый коллектив. Да и сам Стоянов, как утверждают сотрудники, в курсе всех деталей их жизни. Самое страшное для Миши Ранцева и Ольги Зайцевой из салона на Тверской – если кто-нибудь из знакомых скажет Игорю, что недоволен тем, как его обслужили. Знакомых много, получается плотный контроль. А значит, надо все время держать себя в тонусе.

С другой стороны, знающий детали жизни своих подчиненных Стоянов говорит, что груз ответственности за всех людей, которые у него работают, так велик, что уже несколько раз доводил его до кризиса.

– Мне все говорят: не переживай, ты продашь компанию или с тобой что-нибудь случится – о тебе быстро забудут. Наверняка. Но это уже будет другая «Персона», другие люди, другие взаимоотношения.

Однажды, когда Игорь ходил мрачнее тучи, к нему подошла девушка-парикмахер и подарила книгу Джеймса Редфилда «Селестинские пророчества». Стоянов серьезно подсел на эзотерику, задумавшись о саморегенерации и жизненном балансе.

– Саморегенерация – главный аккумулятор жизни. Я не пью алкоголь. Не то чтобы совсем, а просто для меня это не допинг. Вино я попробовал первый раз в 25 лет. Я курю только сигары. Сигареты никогда не курил. В общем, стараюсь не тратить жизнь на то, что мне не нужно. Так что иногда ощущаешь себя вещью в себе, непростым человеком. А отчего бы быть простым? Жизнь -это же не игра об стенку. Если кинул шарик, необязательно он вернется тебе в руки. Скорее всего ты как раз его не поймаешь.

Проще говоря, саморегенерация – это отдых. Игорь любит черно-белые вещи и говорит, что живет в черно-белом мире. Один из способов отдохнуть от него, например,– посмотреть фильм «Убить Билла», где страсти, истории и абсолютный стиль, которого не может быть в жизни.

Жизненный баланс – это еще проще. Редфилд утверждает, что если слишком хорошо с деньгами, значит, где-нибудь с чем-нибудь будет хуже.

– Мне дороже благополучие моей семьи,– говорит Стоянов.

– Значит, свои заработки вы будете сознательно ограничивать?

– Нет, почему? Мы будем развиваться. Сейчас занялись франчайзингом. Пойдем в регионы. Есть предложение развернуться в Европе.

– А что станет с балансом?

– За баланс я не беспокоюсь. Меня один парень знакомый спрашивает: знаешь, почему я не люблю богатых людей в сфере бьюти-бизнеса? Потому что они не умеют работать бесплатно. Вот я могу сделать бесплатно работу, которая мне нравится. А они считают, что, открывая дорогие магазины за полтора миллиона долларов и продавая там все эти Brioni, Fendi, Gucci, Dolce

Gabana, они уже делают благо. Вы когда-нибудь об этом задумывались?

– Чтобы поддерживать баланс в хорошей форме, Стоянов бесплатно учит в своей школе стилистов детей из детдома. В следующем году «Персона» сделает парикмахерами 70, мастерами маникюра и педикюра – десять и администраторами – пять подростков из двух детских домов (No50 и No57), а также из 55-й школы-интерната.

– А вообще, если говорить откровенно, Игорь, сколько денег вы планируете заработать без риска для жизненного баланса?

– У меня сын – необычный парень. Я у него спросил: Дема, как ты считаешь, у человека денег должно быть много или достаточно. А он говорит: достаточно и еще чуть-чуть. В принципе такая формулировка близка и мне.


Игорь застегивает черное пальто, надевает черно-белый шарф, мы поднимаемся из зала школы стилистов в вестибюль салона «Персона Lab» на Кузнецком Мосту. Стоянов подходит к стеклу, через которое видно, как стригут, намыливают и сушат клиентов феном общительные модные ребята.

– Здесь у меня нет почти ничего, что стоит больших денег,– говорит Игорь.– Вместо вывесок – чистое стекло, на полу – камушки, часть стен -неоштукатуренная кирпичная кладка. Люди ходят по деревянным настилам, их не смущает то, что на них смотрят. Они играют в мою игру. Эти люди понимают, насколько их жизнь зависит от того, как они выглядят. Их доверие – вот что я больше всего боюсь потерять.

«БИЗНЕС», No03(03) от 01.12.04

▶▷▶ аудиокнига управление страхом

▶▷▶ аудиокнига управление страхом
скачать игры через торрент р г механикинид фор спид ривалс скачать торрент механикиold good stalker evolution скачать торрент от механиковскачать игру 2014 через торрент от механиков на компьютерgas guzzlers extreme скачать торрент механики на русскомneed for speed most wanted торрент r.g механикискачать игру агент 007 через торрент от механиков бесплатноскачать бордерлендс 1 торрент на русском механикиигры на пк скачать торрент механики от 1 лицаскачать quantum break от механиков через торрент

аудиокнига управление страхом — Yahoo Search Results Yahoo Web Search Sign in Mail Go to Mail» data-nosubject=»[No Subject]» data-timestamp=’short’ Help Account Info Yahoo Home Settings Home News Mail Finance Tumblr Weather Sports Messenger Settings Want more to discover? Make Yahoo Your Home Page See breaking news more every time you open your browser Add it now No Thanks Yahoo Search query Web Images Video News Local Answers Shopping Recipes Sports Finance Dictionary More Anytime Past day Past week Past month Anytime Get beautiful photos on every new browser window Download Виталий Пичугин — Как влюбить в себя (аудиокнига) » Скачать audioknigsu/psihologiya/4520-vitalij-pichugin-kak Cached Лучшая фантастика 2017 ( Аудиокнига ) Лукьяненко С и др 27/12/2018 У чужих берегов ( АудиоКнига ) Лысак Сергей 09/01/2019 Рождение стальной крысы ( аудиокнига ) Гаррисон Гарри Управление (Наталья Колесова) [Елена Коростенская, 2017 mykladorg/5/1/10/upravlenie-natalya-kolesova Cached Управление (Наталья Колесова) [Елена Коростенская, 2017, любовный роман, аудиокнига , MP3, 192kbps] Управление эмоциями (Игорь Вагин) [2011, Психология mykladorg/5/1/17/upravlenie-yemociyami-igor Cached Управление страхом Аудиокнига Александра Никонова посвящена исследованию извилистых Хозе Сильва, Филип Миэле — Управление разумом по методу au-bookscom/hoze-silva-filip-miele-upravlenie-razumom Cached Аудиокнига Управление разумом по методу Сильва Аудиокнига Победа над страхом , паникой и Скачать аудиокниги Метод Сильвы Скачать аудиокниги и слушать askachcom/category/psixologiya/metod-silvy Cached Аудиокнига Роман Борсук «Вакцина от Разговор со страхом 9 Стандартное расслабляющее Кларк Артур — Конец детства (аудиокнига) audioknigsu/tags/Кларк+Артур Cached Создано на Луне и специальное Управление лунного туризма: Необычный ландшафт, слабое тяготение, вид на Землю, загадки Фарсайда, великолепное звездное небо, первые поселения Михаил Глянцев — Управление Подсознанием Части 1-5 libsoftwaresite › Книга › Аудиокнига Аудиокнига Михаил Глянцев — Управление Подсознанием Части 1-5 ( Аудиокнига /2010/Mp3) скачать бесплатно без регистрации Скачать аудиокниги Вагин Игорь Скачать аудиокниги и слушать askachcom/tag/igor-vagin Cached Управление страхом Аудиокнига Игорь Вагин, Антонина Глущай «Поднимись над толпой Книги / Скачать бесплатно — lapshaorg lapshaorg/5/page/1996 Cached Книги / Торрент трекер с удобной навигацией Формат: аудиокнига , MP3, 128kbps Автор: Михаил Барышев Игорь Вагин — Управление эмоциями (Аудиокнига) — 28 Августа orgucozorg/news/igor_vagin_upravlenie_ehmocijami Cached Игры Он-лайн Видео, клипы, ролики Интересное Promotional Results For You Free Download | Mozilla Firefox ® Web Browser wwwmozillaorg Download Firefox — the faster, smarter, easier way to browse the web and all of Yahoo 1 2 3 4 5 Next 15,100 results Settings Help Suggestions Privacy (Updated) Terms (Updated) Advertise About ads About this page Powered by Bing™

  • Игорь Вагин
  • а он стоял рядом
  • побороть чувство вины и избавиться от стыдливости

которая поможет вам научиться контролировать эмоции

поделитесь ссылкой с друзьями в соцсетях Аудиокниги

  • великолепное звездное небо
  • 2017 mykladorg/5/1/10/upravlenie-natalya-kolesova Cached Управление (Наталья Колесова) [Елена Коростенская
  • аудиокнига

аудиокнига управление страхом — Все результаты Игорь Вагин — Управление эмоциями Слушать аудиокнигу онлайн › Психология, философия › Вагин Игорь Похожие Слушать аудиокнигу , читает Прудовский Илья Игорь Вагин предлагает эмоции, преодолеть страх и хроническую тревогу, приобрести уверенность и Избавление от страха и тревоги (слушать аудиокнигу бесплатно Рейтинг: 5 — ‎19 голосов Слушать или скачать аудиокнигу , читает: Игорь Вагин, жанр: Психология, и механизм страха и тревоги, учит контролировать и преодолевать эти Видео 26:39 ॐ Джон Шерман — Страх жизни (аудиокнига, читает Nikosho Ступени Сознания YouTube — 3 июн 2015 г 25:47 СЁРЕН КЬЕРКЕГОР «Страх и трепет» Библейский сюжет Студия Неофит YouTube — 5 мая 2016 г 36:37 Антон Павлович Чехов Страх аудиокнига Литература аудиокниги YouTube — 27 июн 2017 г Все результаты Аудиокнига «Управление страхом» — Синтон wwwsyntone-spbru/library/books/content/6354html Аудиокнига « Управление страхом » Скачать  Вернуться к списку книг Автор: Пичугин В Страницы: 1; Все Оцените материал: ТРЕНИНГИ В ТЕМУ Избавление от страха и тревоги — Аудиокнига — Игорь Вагин — Storytel 28 апр 2014 г — Фрагмент Избавление от страха и тревоги — Игорь Вагин Аудиокнига Известный психолог и Управление эмоциями — Игорь Вагин Аудиокнига «Избавление от страха и тревоги» — слушать онлайн «Избавление от страха и тревоги» — слушайте аудиокнигу автора Игорь Запомните: испытывать страх – не значит быть несмелым, именно способностью справляться со страхом храбрец отличается от труса! Управление Илсе Санд, Аудиокнига Страх близости: Как перестать — ЛитРес › Аудиокниги › Зарубежная психология › Илсе Санд Рейтинг: 4 — ‎17 голосов Аудиокнига Илсе Санд « Страх близости: Как перестать защищаться и начать Стиль управления у более успешных субподрядчиков отличается Аудиокнига «Как победить страх Секретные методики спецслужб 14 апр 2015 г — Секретные методики спецслужб, Леонард Кэмерон Слушать аудиокнигу , читает Станислав Иванов — Страх – это то, с чем мы боремся всю жизнь Наши страхи 1 час 1 минута Скрытое управление человеком Рон Хаббард Страх аудиокнига слушать онлайн, скачать торрент Рон Хаббард Страх аудиокнига слушать онлайн, скачать торрент Классика — Слушать аудиокниги онлайн Клавиши Управления Курсором Как победить страх — Бизнес-тренер Игорь Вагин igor-vaginru/training/kak-pobedit-strah Механизм развития страха Переживание страха у людей с разными психотипами Приемы утилизации страха Управление внутренними Приручение страха — Леви Владимир — Куб — электронная библиотека wwwkoobru/levi/priruchenie_straha Похожие Эта книга — самоучитель бесстрашия и уверенности Вы найдете здесь не только множество техник устранения страха , но и помощь в раскрытии и Победи свой страх (Мэнди Холгейт) — купить в МИФе 12 февр 2018 г — 12главных страхов иплан работы сними Бумажная, электронная книга (epub , mobi, pdf, fb2) Читать отзывы и скачать главу АУДИОКНИГИ САМОРАЗВИТИЕ | ВКонтакте Похожие Здесь можно БЕСПЛАТНО СКАЧАТЬ полезную литературу и аудиокниги АУДИОКНИГИ САМОРАЗВИТИЕ запись закреплена Анти- страх 45:06 Как избавиться от страха – 15 методов — nperov nperovru/soznanie/kak-izbavitsya-ot-straxa-15-metodov/ Похожие Здесь пойдет речь пойдет о том, как избавиться от страха самой разной природы: страха Но в контексте управления страхом такое поведение часто не имеет никакого смысла Просто запустить и слушать медитации Книга «Дар страха Как распознавать опасность и правильно на › Книги › Нехудожественная литература › Право Доступны цифровые, печатные и аудиокниги На сайте вы можете почитать отзывы, рецензии, отрывки Мы бесплатно доставим книгу «Дар страха Теория управления страхом смерти — Википедия Похожие Теория управления страхом смерти (англ terror management theory, TMT) — научная теория из области социальной психологии, предполагающая Аудиокниги слушать онлайн бесплатно и без регистрации в В электронной библиотеке Альдебаран можно слушать онлайн подходе к менеджменту и управлению качеством, обеспечивающем Страх Минул год с того памятного дня, как жители Орбиса утратили свое бессмертие Отзывы о Аудиокнига «Страх» — Эдуард Хруцкий — Отзовик Рейтинг: 4 — ‎1 отзыв Аудиокнига » Страх » — Эдуард Хруцкий — отзывы Отзыв о Аудиокнига Страх – основной метод управления Советской империей Основная тема книги Аудиокнига — популярные книги одноименного издательства Правильная аудиокнига — это пьеса, с актерской игрой, аранжировкой, Прочитал заголовок — « Страх и ненависть в Лас-Вегасе» Хантера С Томпсона В прошлом кассеты и диски, неудобное управление и сложность покупки Аудиокнига «Одна совершенно секретная таблетка от страха Аудиокнига «Одна совершенно секретная таблетка от страха » автора Андрея Курпатова Тренинг управления эмоциями (Нина Рубштейн) — слушать онлайн › Психология, НЛП › Нина Рубштейн Рейтинг: 1 — ‎1 голос слушать книгу Тренинг управления эмоциями автора Нина Рубштейн вас справляться с обидой, ревностью и страхом , научат радоваться жизни Как заставить тревогу и страх работать на себя — Лайфхакер 29 окт 2014 г — Однако страх полезен в некоторых случаях Тревога и страх возникают от неопределённости в будущем, и это вполне Штука дня: голографический автомобильный ассистент с жестовым управлением Страх И Ненависть В Лас Вегасе Аудиокнига Скачать Торрент valosagoskincsesbanyacom//strah-i-nenavist-v-las-vegase-audiokniga-skachat-torre Страх и ненависть в лас вегасе аудиокнига скачать торрент Если они не примут хоть какое-нибудь подобие луны управления , они не смогут спасти Аудиокнига «Одна совершенно секретная таблетка от страха Скачать бесплатно, слушать онлайн аудиокнигу Одна совершенно секретная таблетка от страха MP3 аудиокнига Медиа Вагин ИОУправление эмоциями — МВидео › › MP3 аудиокниги › Аудиокниги MP3 › Медиа Вы можете купить MP3 аудиокнига Медиа Вагин ИО Управление эмоциями в магазинах МВидео по доступной цене MP3 аудиокнига Медиа Вагин Психология — аудиокниги онлайн слушать — AudioKnigaclub Ступень 5: Яблоки падают в небо — слушать аудиокнигу онлайн бесплатно с мировым именем, им написано боле 20 книг по психологии управления , причина такового интереса элементарна — страх смерти, это вам любой 250 лучших бесплатных программ без страха для тех, кому за Марина Виннер , ‎ Маргарита Михайлова — 2017 — ‎Computers Чтобы открыть в программе аудиокнигу , необходимо нажать ссылку (+) Добавить Управление воспроизведением аудиокниги можно осуществлять с Как побороть аэрофобию: лайфхаки от бортпроводников и 25 июл 2018 г — Марина советует больше читать об авиации и избегать информации об В центре по лечению аэрофобии подтверждают, что страх сам не и время суток, убедиться в надежности автоматического управления 5 книг о психологии эмоций — ПостНаука Похожие 13 янв 2015 г — Что читать о природе эмоций и их роли в нашей жизни рекомендует кандидат психологических наук Наталья Кисельникова Страх слушать онлайн Аудиокнига Анатолия Рыбакова бесплатно Слушать онлайн Страх на нашем сайте можно бесплатно в любое время Наслаждайтесь прослушиванием любимых аудиокниг вместе с нами Steam Community :: Group :: Аффирмация от страха аудиокнига Скачать Аффирмация от страха аудиокнига Скачать Похожие аудиокниги : Искусство управления миром — Бронислав Виногродский ( аудиокнига ) Курс «Путь мангуста Успех благодаря страху» | Автор Константин Откройте для себя знание, дающее свободу от оков страха «А если он меня сразу уволит», «А если он не захочет меня слушать , и так далее Гораздо разумнее научиться противостоять страху А ещё Управление страхом Психология — аудиокниги онлайн слушать бесплатно Легкий способ бросить курить — слушать аудиокнигу онлайн бесплатно По статистике, страх перед выступлением занимает вторую строчку после в рейтинге лучших бестселлеров по организации и управлению бизнесом Алкоголь лишь усиливает страх — Lentaru Похожие 27 апр 2016 г — О том, почему возникает страх полета и как с ним бороться, Мой главный совет: не читать советы дилетантов в интернете, а трезво Аудиокниги для всех | — г Дальнегорск Приморского края dalcgbru/аудиокниги-2/аудиокниги/ Похожие Каждый век рождал замечательных музыкантов, в этой аудиокниге вас ждет пройдут босыми ногами по битым стеклам без порезов, боли и страха Вагин, ИО Управление эмоциями: Тренинг Игоря Вагина [Электронный Отзывы о книге Ведомство страха (аудиокнига MP3) — LiveLib 29 рецензий на книгу «Ведомство страха ( аудиокнига MP3)» Грэма Грина Ему показалось, что люди преувеличивают цену счастья Роман именно о том Архив рассылки Стакан жизни или Приручение страха wwwleviru/subscribe/33html Похожие 25 сент 2001 г — От страха люди теряют рассудок, безумеют, тонут, убивают друг не читать , ничего не смотреть и не слушать , не есть или почти не и поддается управлению , и в конце концов делается совершенно ручным App Store: Аудиокниги от Patephone — iTunes — Apple Похожие Рейтинг: 4,9 — ‎22 874 отзыва — ‎Бесплатно — ‎iOS Загрузите этот контент ( Аудиокниги от Patephone) и используйте его на iPhone, Управление подписками и их отмена осуществляются в настройках Редко/умеренно встречающиеся материалы, вызывающие ужас или страх [DOC] Психология страха wwwphantastikecom/practic_psychology/psikhologiya_strakha/zip/ Наконец, управление подданными с помощью страха есть, 3) не читать постоянно мораль о должном поведении и не стыдить по любому поводу; Афиногенов «Страх» • Расшифровка эпизода • Arzamas Драматургом был Александр Афиногенов, а пьеса называлась « Страх » читать Маркса и других теоретиков диалектической мысли и применять этот Ученые: Хеви-метал помогает справиться с депрессией и страхом 21 июл 2016 г — группы Slayer «Angel Of Death» и аудиокниги нейтрального содержания очень важным фактором в теории управления страхом АУДИОКНИГИ СКАЧАТЬ в формате mp3, mp4 на телефон, android В интернет магазине ⭐YAKABOO⭐ вы можете скачать Аудиокниги онлайн в формате mp3, mp4 на телефон или планшет на операционные системы: Страх и ненависть в лас вегасе книга аудиокнига — Hayat Ambalaj wwwhayatambalajcom//strah-i-nenavist-v-las-vegase-kniga-audiokniga-5528xml Марк сформулировал страх и ненависть в лас вегасе книга аудиокнига А теперь не книга система управления охраной труда, потому что не хочу, кто Автор книги «Страх Трамп в Белом доме» рассказал о попытках 12 сент 2018 г — Автор книги » Страх Трамп в Белом доме» рассказал о попытках что ЦРУ ( Центральное разведывательное управление США) хотело Источник отказался уезжать — явно из-за страха перед Читать полностью Подборка сказок для терапии детских страхов | Журнал Рейтинг: 1 — ‎1 голос 27 июн 2017 г — Добрая сказка о страхе темноты для самых маленьких слушателей И первокласснику уже недостаточно просто уметь читать , Аудиокнига «Моделирование будущего Медитации в исполнении Слушать онлайн «Моделирование будущего божественному плану, жить без привязанностей и страха , осознанно выбирать только желанный опыт Электронная аудиокнига : Игорь Вагин — «Как перестать Скачать электронную аудиокнигу автора Игорь Вагин — «Как перестать психотехники – приемы управления и преодоления тревогой и страхом Читать Игорь Вагин: Управление эмоциями (Психология) — Аудиокниги Глава 2 Природа и механизмы страха Глава 3 Управление рисками Глава 4 Управление страхом Глава 5 Работа с хронической тревогой Глава 6 /bo/ — Аудиокниги — 2ch Похожие Недавно, мне повезло наткнуться на Аудиокнигу , с большой буквы Страх и отвращение в Лас-Вегасе читает Найк Борзов Пока единственное, что Художественные аудиокниги | КОБ-Медиа kob-mediaru/?tag=художественные-аудиокниги Похожие 12 апр 2017 г — Tag Archives: Художественные аудиокниги Художественный рассказ о том , как страх убивает Любовь Опубликовано в Аудио | Теги: Глобальное управление , Потреблятство, Философия, Художественная Реклама Аудиокниги в формате mp3, m4b | скачивайте и слушайте‎ Реклама wwwlitresru/Аудиокниги/Скачать_слушать ‎ Самые интересные, популярные аудиокниги В удобном формате Без регистрации! Бестселлеры Аудиокниги в формате MP4 Популярные авторы Услуги: книги в форматах: fb2, pdf, epub, mp3, txt, mp3, iosepub, mobi, m4b Знания И Навыки Жанры Аудиокниг Активация Промокода Серьезное Чтение Жанры Книг 2-я Звенигородская ул, 13 стр 41, Москва Вместе с аудиокнига управление страхом часто ищут управление эмоциями аудиокнига скачать управление гневом аудиокнига скачать аудиокниги аудиокниги по психологии азбук аудиокниги повышение самооценки аудиокнига скачать популярные аудиокниги новые аудиокниги Навигация по страницам 1 2 3 4 Следующая Ссылки в нижнем колонтитуле Россия — Подробнее… Справка Отправить отзыв Конфиденциальность Условия Аккаунт Поиск Карты YouTube Play Новости Почта Контакты Диск Календарь Google+ Переводчик Фото Ещё Покупки Документы Blogger Hangouts Google Keep Jamboard Подборки Другие сервисы Google

pes 2017 полная версия скачать торрент pc repack механикиcall of duty 6 скачать торрент механики pc на русскомfm 15 скачать торрент механикизис вар оф майн скачать торрент механикиplanet explorers скачать русскую версию торрент от механиковcall jf duty black ops 2 скачать торрент механикиalone in the dark у последней черты скачать торрент механикиdoom 4 торрент от механиковскачать торрент игру sniper ghost warrior от механиковмеханик воскрешение торрент смотреть

Яндекс Яндекс Найти Поиск Поиск Картинки Видео Карты Маркет Новости ТВ онлайн Знатоки Коллекции Музыка Переводчик Диск Почта Все Ещё 1 Игорь Вагин — Управление эмоциями Слушать Audioknigiclub › upravlenie-emociyami-igor-vagin Сохранённая копия Показать ещё с сайта Пожаловаться Информация о сайте Подробнее о сайте Слушать аудиокнигу , читает Прудовский Илья Игорь Вагин предлагает специальные психотерапевтические методики, которые помогут Вам научиться контролировать Читать ещё Слушать аудиокнигу , читает Прудовский Илья Игорь Вагин предлагает специальные психотерапевтические методики, которые помогут Вам научиться контролировать эмоции, преодолеть страх и хроническую тревогу, приобрести уверенность и Игорь Вагин предлагает специальные психотерапевтические методики, которые помогут Вам научиться контролировать эмоции, преодолеть страх и хроническую Скрыть 2 Избавление от страха и тревоги (слушать аудиокнигу ) knigavuhecom › book/izbavlenie-ot-strakha-i-… Сохранённая копия Показать ещё с сайта Пожаловаться Информация о сайте Игорь Вагин Известный психолог и бизнес-консультант Игорь Вагин объясняет природу и механизм страха и тревоги Читать ещё Игорь Вагин Известный психолог и бизнес-консультант Игорь Вагин объясняет природу и механизм страха и тревоги, учит контролировать и преодолевать эти эмоции Запомните: испытывать страх – не значит быть несмелым, именно способностью справляться со страхом храбрец отличается от труса! Один из моих клиентов рассказал мне случай о том, как шестеро парней избивали его близкого друга, который заступился за девочек, а он стоял рядом, скованный страхом Скрыть 3 Аудиокнига » Управление эмоциями» Вагин Игорь audioknigalive › upravlenie-emociyami-vagin-igor Сохранённая копия Показать ещё с сайта Пожаловаться Информация о сайте А как их подчинить себе, слушателям расскажет аудиокнига Игоря Вагина « Управление С их помощью можно справиться с внутренними страхами Читать ещё А как их подчинить себе, слушателям расскажет аудиокнига Игоря Вагина « Управление эмоциями» Автор предлагает использовать проверенные психологические методики, которые позволят контролировать собственные чувства С их помощью можно справиться с внутренними страхами , победить тревогу и повысить самооценку Есть эмоции, от которых получится избавиться: давние обиды, гнев, стыдливость и чувство вины Скрыть 4 Аудиокнига « Управление страхом » syntone-spbru › library/books/content/6354html Сохранённая копия Показать ещё с сайта Пожаловаться Информация о сайте 16 февраля Результативное управление персоналом Аудиокнига « Управление страхом »  Вернуться к списку книг Автор: Пичугин В Читать ещё 16 февраля Результативное управление персоналом 19 апреля Интeнсив «Эриксоновский гипноз» Аудиокнига « Управление страхом »  Вернуться к списку книг Автор: Пичугин В Скрыть 5 Содержание аудиокниги : Управление гневом Работа bookgroupru › archive…upravlenie…audioknigahtml Сохранённая копия Показать ещё с сайта Пожаловаться Информация о сайте Описание: Игорь Вагин — Управление эмоциями — аудиокнига Управление страхом Медитация на радости Контроль эмоций Природа и механизмы страха Управление рисками Уверенность и самооценка Вы – эксклюзив Что Читать ещё Описание: Игорь Вагин — Управление эмоциями — аудиокнига Наша современная жизнь проходит в невероятно быстром темпе Управление страхом Медитация на радости Контроль эмоций Природа и механизмы страха Управление рисками Уверенность и самооценка Вы – эксклюзив Что делать со стыдливостью? Боремся с обидами upravlenie _emotsiyamitorrent [16,41 Kb] (cкачиваний: 146) Скрыть 6 Аудиокнига « Управление эмоциями» Игорь Вагин FreeDownloadSeocom › ?p=47557 Сохранённая копия Показать ещё с сайта Пожаловаться Информация о сайте Глава 4 Управление страхом Запись опубликована автором romka888 в рубрике Аудио Материалы, Личностный Рост с метками Аудиокнига , Игорь Вагин, психологические техники Добавьте в закладки постоянную ссылку Читать ещё Глава 4 Управление страхом Глава 5 Работа с хронической тревогой Глава 6 Уверенность и самооценка Запись опубликована автором romka888 в рубрике Аудио Материалы, Личностный Рост с метками Аудиокнига , Игорь Вагин, психологические техники Добавьте в закладки постоянную ссылку Добавить комментарий Отменить ответ Скрыть 7 Управление слушать аудиокнигу онлайн audioknigisite › upravlenie/ Сохранённая копия Показать ещё с сайта Пожаловаться Информация о сайте Колесова Наталья — Управление аудиокнига слушать онлайн бесплатно И спецагенты влюбляются! Сентиментальная история с элементами детектива Потерять брата и друга, а взамен получить любимую женщину… Читать ещё Колесова Наталья — Управление аудиокнига слушать онлайн бесплатно И спецагенты влюбляются! Сентиментальная история с элементами детектива Потерять брата и друга, а взамен получить любимую женщину… Замена? Или утешение? И как в антураже военного учреждения остаться человеком, найти любовь Скрыть 8 Аудиокнига Игорь Вагин Управление эмоциями askachcom › igor-vagin-upravlenie-emociyami/ Сохранённая копия Показать ещё с сайта Пожаловаться Информация о сайте страха Глава 3 Управление рисками Глава 4 Управление страхом Глава 5 Здесь вы можете скачать аудиокнигу Игорь Вагин « Управление эмоциями» или слушать аудиокнигу онлайн Читать ещё Глава 1 Контроль эмоций Глава 2 Природа и механизмы страха Глава 3 Управление рисками Глава 4 Управление страхом Глава 5 Работа с хронической тревогой Глава 6 Уверенность и самооценка Глава 7 Вы — эксклюзив Глава 8 Что делать с виной? Глава 9 Что делать со стыдливостью? Глава 10 Боремся с обидами Глава 11 Управление гневом Глава 12 Здесь вы можете скачать аудиокнигу Игорь Вагин « Управление эмоциями» или слушать аудиокнигу онлайн Скрыть 9 Публицистика – Управление эмоциями (цифровая версия) online1Cru › Аудиокниги › record/20830794 Сохранённая копия Показать ещё с сайта Пожаловаться Информация о сайте Подробнее о сайте Представляем вашему вниманию аудиокнигу Управление эмоциями, которая поможет вам научиться контролировать эмоции, преодолеть страх и хроническую тревогу, приобрести уверенность и повысить самооценку Читать ещё Представляем вашему вниманию аудиокнигу Управление эмоциями, которая поможет вам научиться контролировать эмоции, преодолеть страх и хроническую тревогу, приобрести уверенность и повысить самооценку Жанр: ПублицистикаПублицистика Издатель: Ардис Язык: РусскийРусский Серия: Искусство успеха Битрейт: 160 Kbit/s Формат записи: mp3 Автор: Вагин Игорь Исполнители: Прудовский ИльяПрудовский Илья НДС включен в цену Описание Скрыть 10 Вагин Игорь — Избавление от страха и тревоги аудиокнига book-audiocom › 33798:vagin-igor-izbavlenie-ot-… Сохранённая копия Показать ещё с сайта Пожаловаться Информация о сайте Вагин Игорь Известный психолог и бизнес-консультант Игорь Вагин объясняет природу и механизм страха и тревоги Читать ещё Вагин Игорь Известный психолог и бизнес-консультант Игорь Вагин объясняет природу и механизм страха и тревоги, учит контролировать и преодолевать эти эмоции Запомните: испытывать страх – не значит быть несмелым, именно способностью справляться со страхом храбрец отличается от труса!Один из моих клиентов рассказал мне случай о том, как шестеро парней избивали его близкого друга, который заступился за девочек, а он стоял рядом, скованный страхом Скрыть Аудиокнига Тренинг управления эмоциями – слушать fictionbookru › author/nina_rubshteyin/trening_… Сохранённая копия Показать ещё с сайта Пожаловаться Информация о сайте В аудиокниге Нины Рубштейн, представляемой студией «Ардис», содержаться 43 простых упражнения Эта книга – уникальный тренинг по управлению эмоциями Простые упражнения помогут вам стать хозяином своих чувств Читать ещё В аудиокниге Нины Рубштейн, представляемой студией «Ардис», содержаться 43 простых упражнения, которые научат вас справляться с обидой, ревностью и страхом , научат радоваться жизни Наша жизнь наполнена различными чувствами и эмоциями: мы любим и ревнуем, обожаем и ненавидим, обижаемся и вдохновляемся Эта книга – уникальный тренинг по управлению эмоциями Простые упражнения помогут вам стать хозяином своих чувств, своего настроения Скрыть Вагин Игорь Управление эмоциями [AUDIO] — Все для twirpxcom › file/1044138/ Сохранённая копия Показать ещё с сайта Пожаловаться Информация о сайте Подробнее о сайте Природа и механизмы страха Управление рисками Управление страхом Работа с хронической тревогой Уверенность и самооценка Читать ещё Природа и механизмы страха Управление рисками Управление страхом Работа с хронической тревогой Уверенность и самооценка Что делать со стыдливостью? Боремся с обидами Управление гневом Медитация на радости Чтобы скачать этот файл зарегистрируйтесь и/или войдите на сайт используя форму сверху Скрыть Аудиокнига Управление эмоциями igor-vaginru › catalog/audiokniga-upravlenie… Сохранённая копия Показать ещё с сайта Пожаловаться Информация о сайте Книги и Аудиокниги Игоря Вагина » Аудиокнига Управление эмоциями Аудиокнига Управление эмоциями Понравился материал? Читать ещё Книги и Аудиокниги Игоря Вагина » Аудиокнига Управление эмоциями Аудиокнига Управление эмоциями Понравился материал? Игорь Вагин предлагает специальные психотерапевтические методики, которые помогут Вам научиться контролировать эмоции, преодолеть страх и хроническую тревогу, приобрести уверенность и повысить самооценку, побороть чувство вины и избавиться от стыдливости, управлять гневом, справиться с обидами Скрыть Аудиокниги Игорь Вагин — Управление эмоциями » audio-knigkiru › Психология › …-igor-vagin-upravlenie… Сохранённая копия Показать ещё с сайта Пожаловаться Информация о сайте аудиокнигу : Управление эмоциями Скачать аудиокнигу у партнера Если вам понравилась аудиокнига «Игорь Вагин — Управление эмоциями», поделитесь ссылкой с друзьями в соцсетях Аудиокниги , опубликованные очень Читать ещё аудиокнигу : Управление эмоциями Скачать аудиокнигу у партнера Если вам понравилась аудиокнига «Игорь Вагин — Управление эмоциями», поделитесь ссылкой с друзьями в соцсетях Аудиокниги , опубликованные очень давно, могут быть уже недоступны О сайте У нас вы сможете скачать книги без регистрации Бесплатное скачивание запрещено в связи с авторскими правами Широкий ассортимент авторов и жанров Скрыть Игорь Вагин — Управление эмоциями ( Аудиокнига ) ArtPlotru › …audiobook…upravlenie…audioknigahtml Сохранённая копия Показать ещё с сайта Пожаловаться Информация о сайте страха Глава 3 Управление рисками Глава 4 Управление страхом Глава 5 Название: Управление эмоциями Автор: Игорь Вагин Издательство: Ардис Эту книгу озвучил: И Е Прудовский Год выпуска: 2009 Жанр: Психология Аудио кодек Читать ещё Содержание: Глава 1 Контроль эмоций Глава 2 Природа и механизмы страха Глава 3 Управление рисками Глава 4 Управление страхом Глава 5 Работа с хронической тревогой Глава 6 Уверенность и самооценка Глава 7 Вы — эксклюзив Глава 8 Что делать с виной? Название: Управление эмоциями Автор: Игорь Вагин Издательство: Ардис Эту книгу озвучил: И Е Прудовский Год выпуска: 2009 Жанр: Психология Аудио кодек: mp3 Битрейт аудио Скрыть Серия аудиокниг Страх – Скачать все книги из серии Бестселлеры Аудиокниги Новинки Популярные авторы litresru Не подходит по запросу Спам или мошенничество Мешает видеть результаты Информация о сайте реклама Слушать и скачать серию книг Роя в mp3, на мобильный Без регистрации! Контактная информация +7 (495) 230-00-40 круглосуточно 18+ Испытываете страх ? / valemidinru Состав Показания к применению Валемидин Плюс Эксперты valemidinru › чувство-страха Не подходит по запросу Спам или мошенничество Мешает видеть результаты Информация о сайте реклама Валемидин — успокоительное растительного происхождения Всего за 179 руб! Контактная информация +7 (812) 647-02-46 пн-пт 10:00-18:00 Есть противопоказания Посоветуйтесь с врачом Вместе с « аудиокнига управление страхом » ищут: аудиокнига управление персоналом аудиокнига управление разумом по методу сильва скачать бесплатно аудиокнига управление проектами аудиокнига управление персоналом слушать онлайн аудиокнига управление эмоциями аудиокнига управление людьми аудиокнига управление персоналом слушать аудиокнига управление жизненным циклом корпорации аудиокнига управление гневом аудиокнига управление 1 2 3 4 5 дальше Bing Google Mailru Нашлось 62 млн результатов Дать объявление Показать все Регистрация Войти ЯндексБраузер с защищённым режимом ускоряет загрузку сайтов и видео 0+ Закрыть Установить Спасибо, что помогаете делать Яндекс лучше! Эта реклама отправилась на дополнительную проверку ОК ЯндексДирект Попробовать ещё раз Москва Настройки Клавиатура Помощь Обратная связь Для бизнеса Директ Метрика Касса Телефония Для души Музыка Погода ТВ онлайн Коллекции Яндекс О компании Вакансии Блог Контакты Мобильный поиск © 1997–2019 ООО «Яндекс» Лицензия на поиск Статистика Поиск защищён технологией Protect Попробуйте быстрый Браузер с технологией защиты Протект 0+ Скачать Будьте в Плюсе

Тип лицензияFree
Кол-во просмотров257
Кол-во загрузок132 раз

Константин Балакирев (Konstantin Balakirev) (Актер, Люди за кадром): фото, биография, фильмография, новости

Российский актер театра и кино.

Биография Константина Балакирева

Константин Николаевич Балакирев родился 25 мая 1980 года в Москве. Уже юношей знал, что хочет стать актером. После школы служил в Чечне, был награжден медалью «За отвагу». Вернувшись из армии, поступил в технический институт, откуда был отчислен. А вскоре стал студентом Театрального училища имени Щукина (курс Юрия Шлыкова), которое успешно окончил в 2006 году.

Кинокарьера Константина Балакирева

Впервые на экране актер появился в 2007 году. Тогда с участием Балакирева вышли сериал «Ликвидация», а также основанный на реальных событиях фильм Алексея Балабанова «Груз 200», где Константин исполнил роль Коли Горбунова, погибшего солдата из Афганистана, привезенного в цинковом гробу, и картина Валерия Тодоровского «Тиски».

Затем фильмографию Константина пополнила роль бесшабашного Дрына в «Стилягах» (2008), съемки в проектах «Дикий» (2009), «Русский шоколад» (2010), «Была любовь» (2010), «Сорок третий номер» (2010), «Морпехи» (2011). Актер появился в лентах «Молога. Русская Атлантида», «Белая ворона», «Ангелы революции» и получил партию золотоискателя по кличке Кефир в российском художественном фильме режиссера Александра Мельника «Территория» — экранизации одноимённого романа Олега Куваева. В остросюжетной картине, повествующей об открытии грандиозного месторождения золота на Крайнем Северо-Востоке СССР, Балакирев снялся наряду с Григорием Добрыгиным, Константином Лавроненко, Егором Бероевым и Евгением Цыгановым.

Константин Балакирев: Я очень люблю советское кино — серьезное, мощное. На базе этого интереса стал читать советскую литературу. И в этом плане роман Олега Куваева, по которому снята «Территория», полностью совпал с моими интересом. Школьная программа нам дает искаженное понимание хорошей литературы. У того же Горького есть вещи более колоссальные, способные повлиять на твой мир, чем «Песня о буревестнике» или «Старуха Изергиль». О том, что есть и другая литература, в школе не говорят. С кино то же самое.

В творческой копилке Балакирева нашлось место и проектам «Барсы», «Ищейка», «Шакал», «Анна-детективъ». В 2017-м он снялся в «Рубеже», а в следующем году с его участием вышли сериалы «Крепость Бадабер», «Месть».

Личная жизнь Константина Балакирева

Актер женат. Его супруга по образованию сценарист. Пара воспитывает детей.

Константин Балакирев (из интервью 2015 года): Моя супруга хорошо разбирается в кино, она по профессии сценарист. Правда, несколько лет назад сменила деятельность на «профессию» мамы — надо сказать, самую сложную в мире. Материал для съемок я выбираю сам, а дальше от семьи всегда идет только помощь.

Фильмография Константина Балакирева

  • Актер
  • Месть (сериал, 2018)
  • Крепость Бадабер (мини-сериал, 2018)  … Нарышкин
  • Рубеж (2017)
  • Анна-детективъ (сериал, 2016)… Сурин
  • Расплата (сериал, 2016)
  • Шакал (сериал, 2016)  … Игорь Говорков, инкассатор
  • Тихий Дон (сериал, 2015)  … Пленный красноармеец
  • Пасечник 2 (сериал, 2015)… прапорщик Мохнаткин
  • Ищейка (сериал, 2015)… Роман Кислицын
  • Барсы (мини-сериал, 2015)… Валентин Пархоменко, журналист
  • Медвежья хватка (мини-сериал, 2014)
  • Территория (2014)  … Кефир
  • Мой любимый папа (сериал, 2014)  … Храповик
  • Ангелы революции (2014)  … Николай
  • Любить нельзя ненавидеть (сериал, 2014)… Михаил Салтыков, журналист
  • Берег Надежды (мини-сериал, 2013)  … Степан
  • Женщины на грани (сериал, 2013)  … Харченко
  • Не отпускай меня (мини-сериал, 2013)  … Юрок, браконьер
  • Пепел (сериал, 2013)  … Андрей Петрищев
  • Белая ворона (ТВ, 2011)  … Солоха
  • Молога. Русская Атлантида (ТВ, 2011)  … Глухов
  • Каменская 6 (сериал, 2011)  . .. Женя
  • Черная метка (мини-сериал, 2011)  … Витя Кориков
  • Морпехи (сериал, 2011)  … Кок
  • Сорок третий номер (сериал, 2010)  … молодой смертник
  • Дежурный ангел (сериал, 2010)  … Всеволод
  • Была любовь (сериал, 2010)  … Юрка Шаповалов
  • Путь к себе (ТВ, 2010)  … Антон, сын квартирной хозяйки
  • Метель (мини-сериал, 2010)  … друг Вари
  • Земля людей (2010)  … водитель «УРАЛа»
  • Интерны (сериал, 2010 – 2016)  … (34-я серия)
  • Русский шоколад (сериал, 2010)  … Василий Пахомов
  • Дикий (сериал, 2009)  … Кондрашов
  • Исаев (сериал, 2009)  … пограничник
  • Никто, кроме нас… (2008)  … Геша Вагин
  • Стиляги (2008)  … Дрын
  • Красное на белом (мини-сериал, 2008)… водитель
  • Тиски (2007)  … Кепка
  • Ликвидация (сериал, 2007)  … Охрятин
  • Груз 200 (2007)  … Коля Горбунов
  • Затерянные в осени (2006, короткометражный)
  • Дубляж
  • Шпионский мост (2015) Bridge of Spies
  • Эверест (2015) Everest

Органы местного самоуправления Санкт‑Петербурга — Официальный сайт Администрации Санкт‑Петербурга

№ п/п

Наименование внутригородского муниципального образования Санкт‑Петербурга

Фамилия, имя, отчество главы муниципального образования

Фамилия, имя, отчество главы местной администрации


Почтовый адрес


Официальный интернет-сайт муниципального образования


МО Коломна

Столяров Олег Евгеньевич

Шелепень Александр Александрович



190068, Санкт‑Петербург, набережная Крюкова канала, д. 11/43

[email protected];

[email protected]



МО Сенной округ

Астахова Наталия Владимировна




190031, Санкт‑Петербург, набережная реки Фонтанки, д. 89

[email protected];



МО Адмиралтейский округ

Барканов Евгений Павлович

Крылов Николай Вячеславович


190000, Санкт‑Петербург, ул. Декабристов, д. 18

[email protected]



МО Семеновский

Липинский Ян Александрович

Лаптев Сергей Альбертович


190013, Санкт‑Петербург, ул. Серпуховская, д. 16 (муниципальный совет)

[email protected]






191180, Санкт‑Петербург, Большой Казачий пер. , д. 5-7 (местная администрация)

[email protected]


МО Измайловское

Бубнова Ольга Владимировна

Терентьев Игорь Михайлович



190005, Санкт‑Петербург, ул. Егорова, д. 18

[email protected];

[email protected]



МО Екатерингофский

Смакотин Олег Алексеевич



190020, Санкт‑Петербург, Нарвский пр., д. 16

[email protected]



МО № 7

Степанов Сергей Александрович

Гоголкин Александр Алексеевич



199178, Санкт‑Петербург, 12-я линия В.О., д. 7, 2-й этаж

[email protected]



МО Васильевский

Фигурин Игорь Стефанович

Иванов Дмитрий Владимирович




199004, Санкт‑Петербург, 4-я линия В. О., д. 45

[email protected]



МО Гавань

Вавилина Нэлли Юрьевна





199406, Санкт‑Петербург, Васильевский остров, ул. Шевченко, д. 29

[email protected];

[email protected]



МО Морской




199226, Санкт‑Петербург, ул. Кораблестроителей, д. 21, корп. 1, лит. Д

[email protected]



МО Остров Декабристов

Погосян Ольга Сергеевна

Горчаков Эдвин Евгеньевич


199397, Санкт‑Петербург, ул. Кораблестроителей, д. 35, корп. 5

[email protected]



МО Сампсониевское

Рыбчак Мария Михайловна

Волхонин Николай Витальевич


194100, Санкт‑Петербург, Большой Сампсониевский пр. , д. 86

[email protected]



МО Светлановское

Евстафьева Янина Владимировна

Кузьмин Сергей Сергеевич




194223, Санкт‑Петербург, пр. Тореза, д. 35/2

[email protected];

[email protected]



МО Сосновское

Загородникова Светлана Григорьевна

Грицак Игорь Викторович


194354, Санкт‑Петербург, ул. Есенина, д. 7

[email protected];

[email protected]



МО № 15

Виноградов Сергей Николаевич

Демкович Василий Иванович


194352, Санкт‑Петербург, Сиреневый бульвар, д. 18, корп. 1, лит. А

[email protected];

[email protected]



МО Сергиевское

Душина Оксана Николаевна

Исаев Михаил Александрович



194356, Санкт‑Петербург, пр. Энгельса, д. 131, корп. 1, лит. А

[email protected]



МО Шувалово-Озерки

Альхов Константин Олегович

Фролов Василий Николаевич



194356, Санкт‑Петербург, пр. Луначарского, д. 5

[email protected]



МО поселок Парголово

Кутыловская Ольга Алексеевна

Могильникова Галина Александровна



194362, Санкт‑Петербург, п. Парголово, ул. Ломоносова, д. 17

[email protected]



МО поселок Левашово

Федоров Сергей Николаевич





194361, Санкт‑Петербург, п. Левашово, ул. Железнодорожная, д. 46

[email protected]



МО Гражданка

Беляева Елена Вячеславовна

Ласкателева Ирина Михайловна




195256, Санкт‑Петербург, пр. Науки, д. 41, а/я 15

[email protected]



МО Академическое

Пыжик Игорь Григорьевич

Гаврилова Елена Алексеевна


195257, Санкт‑Петербург, Гражданский пр., д. 84

[email protected]



МО Финляндский округ

Беликов Всеволод Федорович

Шесточенко Игорь Борисович


195221, Санкт‑Петербург, пр. Металлистов, д. 93, лит. А

[email protected]



МО № 21

Костина Валентина Дмитриевна

Учаева Марина Ивановна



195265, Санкт‑Петербург, ул. Лужская, д. 10

[email protected];

[email protected]



МО Пискаревка

Умнова Оксана Николаевна

Фильчаков Владимир Борисович


195067, Санкт‑Петербург, Пискаревский пр. , д. 52, лит. А, пом. 38-Н

[email protected]



МО Северный

Миронкин Вячеслав Игоревич

Пустосмехова Светлана Владимировна



195274, Санкт‑Петербург, пр. Луначарского, д. 80, корп. 1, лит. Б

[email protected]



МО Прометей

Суворов Алексей Борисович

Кухарева Галина Викторовна


195276, Санкт‑Петербург, ул. Тимуровская, д. 8, корп. 1

[email protected]



МО Княжево

Козлов Дмитрий Юрьевич

Галь Александр Сергеевич

377-15-17, 377-21-37

198207, Санкт‑Петербург, Ленинский пр., д. 119

[email protected]



МО Ульянка

Хлебникова Оксана Николаевна

Русинович Станислав Александрович


198261, Санкт‑Петербург, ул. Генерала Симоняка, д. 9

[email protected]



МО Дачное

Сагалаев Вадим Александрович

Середкин Михаил Борисович



198255, Санкт‑Петербург, пр. Ветеранов, д. 69

[email protected]



МО Автово

Трусканов Геннадий Борисович

Кесаев Алан Владимирович


198152, Санкт‑Петербург, ул. Краснопутиловская, д. 27

[email protected]



МО Нарвский округ

Каптурович Александр Георгиевич

Мацко Елена Борисовна



198095, Санкт‑Петербург, ул. Оборонная, д. 18

[email protected]



МО Красненькая речка

Абраменко Александр Олегович




198302, Санкт‑Петербург, пр. Маршала Жукова, д. 20

[email protected]



МО Морские ворота

Привалов Александр Алексеевич



198184, Санкт‑Петербург, Канонерский остров, д. 8-А

[email protected]



МО город Колпино

Милюта Олег Эдвардович

Лащук Евгений Александрович



196655, Санкт‑Петербург, г. Колпино, Красная ул., д. 1

[email protected];

[email protected]



МО поселок Понтонный

Дюбин Иван Николаевич

Сумбаров Виталий Николаевич



196643, Санкт‑Петербург, п. Понтонный, ул. А.Товпеко, д. 10

[email protected]

[email protected]



МО поселок Усть-Ижора

Кострова Елена Александровна

Мацепуро Наталья Ивановна



196645, Санкт‑Петербург, п. Усть-Ижора, Шлиссельбургское ш., д. 219

[email protected]



МО поселок Петро-Славянка

Меньшикова Наталья Владимировна

Боловинцева Светлана Валерьевна


196642, Санкт‑Петербург, п. Петро-Славянка, ул. Труда, д. 1

[email protected]



МО поселок Саперный

Палшкова Евгения Анатольевна

Харитонов Дмитрий Олегович



196644, Санкт‑Петербург, п. Саперный, ул. Дорожная, д. 2

[email protected]



МО поселок Металлострой

Антонова Наталия Ивановна

Смирнов Юрий Сергеевич



196641, Санкт‑Петербург, п. Металлострой, ул. Центральная, д. 22

[email protected];

[email protected]



МО Полюстрово

Жабрев Андрей Анатольевич

Жабрев Андрей Анатольевич



195253, Санкт‑Петербург, пр. Энергетиков, д. 70, к. 3

[email protected]



МО Большая Охта

Паялин Николай Львович

Семенова Наталия Владимировна



195027, Санкт‑Петербург, Тарасова ул., д. 9

[email protected]



МО Малая Охта

Монахов Дмитрий Иванович

Бобков Кирилл Сергеевич



195112, Санкт‑Петербург, Новочеркасский пр., д. 25, корп. 2, лит. А

[email protected]



МО Пороховые

Литвинов Валерий Александрович

Литвинов Валерий Александрович



195298, Санкт‑Петербург, пр. Косыгина, д. 27/1

[email protected]



МО Ржевка

Черевко Вячеслав Григорьевич

Кибирев Борис Владимирович



195030, Санкт‑Петербург, ул. Коммуны, д. 52

[email protected]



МО Юго-Запад

Семенов Олег Александрович

Шеромов Валерий Викторович


198330, Санкт‑Петербург, Петергофское шоссе, д. 3/2

[email protected]



МО Южно-Приморский

Алескеров Андрей Энверович

Гудадзе Паата Сергеевич


198332, Санкт‑Петербург, ул. Доблести, д. 20, кор. 1

[email protected]



МО Сосновая Поляна

Давыдова Светлана Юрьевна

Бабаёв Максим Захарович



198264, Санкт‑Петербург, ул. Пограничника Гарькавого, д. 22, кор. 3

[email protected]



МО Урицк

Прокопчик Николай Кузьмич

Ромашкина Анна Владимировна



198205, Санкт‑Петербург, ул. Партизана Германа, д. 22

[email protected]



МО Константиновское

Зыкова Татьяна Викторовна

Лавриненко Андрей Александрович


198264, Санкт‑Петербург, пр. Ветеранов, д. 166, лит. А

[email protected]



МО Горелово

Иванов Дмитрий Аркадьевич

Лебедева Наталья Сергеевна



198323, Санкт‑Петербург, Красносельское шоссе, д. 46, лит. А

[email protected];

[email protected]



МО город Красное Село





198320, Санкт‑Петербург, Красное Село, пр. Ленина, д. 85

[email protected]



МО город Кронштадт

Чашина Наталия Федоровна

Бандура Сергей Алексеевич




197760, Санкт‑Петербург, г. Кронштадт, ул. Зосимова, д. 11, лит. А

[email protected];

[email protected]




МО город Зеленогорск

Семенов Борис Анатольевич

Долгих Игорь Анатольевич


197720, Санкт‑Петербург, г. Зеленогорск, ул. Исполкомская, д. 5

[email protected]



МО город Сестрорецк

Иванов Андрей Владимирович

Овсянникова Татьяна Семеновна


197706, Санкт‑Петербург, г. Сестрорецк, Приморское шоссе, д. 280, лит. А

[email protected]



МО поселок Белоостров

Алексеева Ольга Леонидовна

Чечин Дмитрий Денисович



197730, Санкт‑Петербург, п. Белоостров, ул. Восточная (Дюны), д. 11 а

[email protected]



МО поселок Комарово

Журавская Анастасия Сергеевна

Торопов Евгений Александрович



197733, Санкт‑Петербург, п. Комарово, ул. Цветочная, д. 22

[email protected]



МО поселок Молодежное

Холодилова Ирина Александровна

Денисов Никита Сергеевич


197729, Санкт‑Петербург, п. Молодёжное, ул. Правды, д. 5

[email protected]



МО поселок Песочный

Чапаева Елена Андреевна

Шувалова Алла Викторовна



197758, Санкт‑Петербург, п. Песочный, ул. Советская, д. 6

[email protected]



МО поселок Репино

Лебедева Ирина Анатольевна

Семенова Ирина Геннадьевна



197738, Санкт‑Петербург, п. Репино, Приморское шоссе, д. 443

[email protected]



МО поселок Серово

Бабенко Андрей Васильевич

Федорова Галина Васильевна



197720, Санкт‑Петербург, г. Зеленогорск, пр. Ленина, д. 15

[email protected]



МО поселок Смолячково

Власов Антон Евгеньевич

Чулин Андрей Тихонович



197720, Санкт‑Петербург, г. Зеленогорск, пр. Ленина, д. 14, лит. А, пом. 1-Н

[email protected];

[email protected]



МО поселок Солнечное

Сафронов Михаил Александрович

Барашкова Виктория Анатольевна



197739, Санкт‑Петербург, пос. Солнечное, Вокзальная ул., д. 15

[email protected];

[email protected]



МО поселок Ушково

Машанов Иван Андреевич

Захова Татьяна Викторовна



197720, Санкт‑Петербург, г. Зеленогорск, пр. Ленина, д. 25

[email protected]



МО Московская застава

Докукин Юрий Валентинович

Морозов Игорь Вячеславович



196105, Санкт‑Петербург, ул. Свеаборгская, д. 8

[email protected];




МО Гагаринское

Трифонова Галина Федоровна

Трусников Михаил Владимирович




196244, Санкт‑Петербург, Витебский пр., д. 41/1

[email protected];

[email protected]



МО Новоизмайловское

Шубин Сергей Борисович

Смирнов Евгений Эдуардович



196247, Санкт‑Петербург, Новоизмайловский пр., д. 85, лит. А

[email protected]



МО Пулковский меридиан

Макаров Виктор Алексеевич

Чистяков Дмитрий Андреевич



196070, Санкт‑Петербург, ул. Победы, д. 8

[email protected];

[email protected]



МО Звездное

Разинков Максим Андреевич

Тришина Юлия Николаевна


196066, Санкт‑Петербург, Алтайская ул., д. 13

[email protected]



МО Невская застава

Карпов Павел Константинович

Пронин Алексей Владимирович


192148, Санкт‑Петербург, ул. Седова, д. 19

[email protected]



МО Ивановский

Кузьмина Светлана Викторовна

Попов Леонид Игоревич



192131, Санкт‑Петербург, ул. Ивановская, д. 26

[email protected]



МО Обуховский

Бакулин Владислав Юрьевич

Кудровский Игорь Олегович




192012, Санкт‑Петербург, 2-й Рабфаковский пер., д. 2

[email protected]



МО Рыбацкое

Евсина Любовь Владимировна

Буланович Владимир Андреевич


192177, Санкт‑Петербург, Прибрежная ул., д. 16

[email protected]



МО Народный

Бушин Вадим Владимирович

Сучилин Игорь Валерьевич


193079, Санкт‑Петербург, ул. Новоселов, д. 5-А

[email protected] www.monaro.ru


МО № 54

Гусаков Юрий Алексеевич

Девяткин Александр Валентинович



193230, Санкт‑Петербург, Дальневосточный пр., д. 42

[email protected]



МО Невский округ

Кочанжи Сергей Павлович

Данилов Дмитрий Юрьевич



193231, Санкт‑Петербург, ул. Коллонтай, д. 21, корп. 1

[email protected]



МО Оккервиль

Бондарев Сергей Евгеньевич

Житников Игорь Владимирович



193312, Санкт‑Петербург, ул. Коллонтай, д. 41/1

[email protected];

[email protected]



МО Правобережный

Гордин Эдуард Исакович

Тонкель Игорь Ростиславович



193231, Санкт‑Петербург, ул. Латышских Стрелков, д. 11, корп. 4

[email protected]



МО Введенский

Калядин Олег Степанович

Поскребышева Татьяна Евгеньевна



197198, г. Санкт‑Петербург, ул. Введенская, д. 7

[email protected]



МО Кронверкское

Матюшин Вячеслав Алексеевич

Соколовский Андрей Анатольевич



197101, Санкт‑Петербург, ул. Ленина, д. 12/36

[email protected]



МО Посадский

Панов Юрий Алексеевич

Высоцкий Дмитрий Олегович


197046, Санкт‑Петербург, Большая Посадская, д. 4, лит. Д

[email protected]



МО Аптекарский остров

Титенко Никита Юрьевич

Рыбников Антон Олегович



197022, Санкт‑Петербург, ул. Льва Толстого, д. 5

[email protected];

[email protected]



МО Округ Петровский

Вагин Дмитрий Феликсович

Томов Александр Сергеевич


197198, Санкт‑Петербург, ул. Гатчинская, д. 16

[email protected]



МО Чкаловское

Мартинович Николай Леонидович

Пантела Олег Николаевич



197110, Санкт‑Петербург, ул. Большая Зеленина, д. 20

[email protected]



МО поселок Стрельна

Беленков Валерий Николаевич

Климачева Ирина Алексеевна



198515, Санкт‑Петербург, г. Стрельна, Санкт‑Петербургское шоссе, д. 69

[email protected]



МО город Петергоф

Шифман Александр Викторович

Егорова Татьяна Сергеевна



198510, Санкт‑Петербург, г. Петергоф, ул. Самсониевская, д. 3

[email protected];

[email protected]



МО город Ломоносов

Смольникова Надежда Николаевна

Семенов Александр Николаевич



198412, Санкт‑Петербург, г. Ломоносов, Дворцовый пр., д. 40

[email protected];

[email protected]



МО Лахта-Ольгино

Богданов Павел Евгеньевич

Чепарский Владимир Игоревич



197229, Санкт‑Петербург, п. Ольгино, ул. Советская, д. 2

[email protected]



МО № 65

Белов Александр Юрьевич

Жуков Александр Юрьевич


197372, Санкт‑Петербург, Богатырский пр-т, д. 59, корп. 1

[email protected]



МО Ланское

Дорожков Артем Алексеевич

Доброхотов Михаил Алексеевич


197183, Санкт‑Петербург, ул. Сестрорецкая, д. 7



МО Комендантский аэродром

Рябыкина Маргарита Феликсовна

Брызгалова Марина Юрьевна




197348, Санкт‑Петербург, Богатырский пр., д. 7, корп. 5

[email protected]



МО Озеро Долгое

Байдалаков Виктор Владимирович

Ходырева Светлана Николаевна


197349, Санкт‑Петербург, пр. Испытателей, д. 31, корп. 1

[email protected]



МО Юнтолово

Гревцева Светлана Кузьминична

Ковба Елена Николаевна


197373, Санкт‑Петербург, ул. Шаврова, д. 5, корп. 1

[email protected]



МО Коломяги

Борисенко Сергей Эдуардович

Каримов Рустам Ильдусович


197375, Санкт‑Петербург, Земский пер., д. 7

[email protected];

[email protected]



МО поселок Лисий Нос

Грудников Вадим Маркович

Сафронов Сергей Алексеевич



197755, Санкт‑Петербург, п. Лисий Нос, Холмистая, д. 3/5

[email protected]



МО город Пушкин

Гребенёв Николай Яковлевич

Каратуев Артем Михайлович



196600, Санкт‑Петербург, г. Пушкин, Октябрьский бульвар, д. 24

[email protected];

[email protected]



МО поселок Шушары

Медведев Евгений Константинович




196626, Санкт‑Петербург, п. Шушары, ул. Школьная, д. 5, лит. А

[email protected];

[email protected]



МО поселок Александровская

Косицына Татьяна Анатольевна

Кирин Кирилл Сергеевич



196631, Санкт‑Петербург, п. Александровская, Волхонское ш., д. 33

[email protected]



МО город Павловск

Зибарев Валерий Викторович

Козлова Алла Владимировна



196620, Санкт‑Петербург, г. Павловск, Песчаный пер., д. 11/16

[email protected]



МО поселок Тярлево

Бекеров Геннадий Александрович

Николаев Андрей Олегович


196625, Санкт‑Петербург, г. Павловск, п. Тярлево, ул. Новая, д. 1

[email protected]



МО Волковское

Куренев Михаил Юрьевич

Темников Александр Сергеевич



192102, Санкт‑Петербург, ул. Стрельбищенская, д. 22

[email protected]



МО № 72

Швец Павел Евгеньевич

Тенищева Ольга Гильмановна


192241, Санкт‑Петербург, ул. Пражская, д. 35

[email protected]



МО Купчино

Пониматкин Алексей Владимирович

Алексеева Ольга Олеговна


192212, Санкт‑Петербург, ул. Будапештская, д. 19, корп. 1 (муниципальный совет)

[email protected]





192071, Санкт‑Петербург, ул. Бухарестская, д. 43, лит. А (местная администрация)

[email protected]


МО Георгиевский

Жолдасов Виталий Владимирович

Козицина Марина Вячеславовна



192286, Санкт‑Петербург, ул. Димитрова, д. 18, к. 1, лит. А

[email protected]



МО № 75

Коробко Василий Андреевич

Новик Трофим Викторович


192289, Санкт‑Петербург, ул. Малая Балканская, д. 58

[email protected]



МО Балканский

Лебедев Савелий Андреевич

Агеева Марина Александровна



192283, Санкт‑Петербург, Купчинская ул., д. 32, лит. В

[email protected]



МО Дворцовый округ

Бисерова Мария Владимировна

Скорописов Дмитрий Юрьевич


191186, Санкт‑Петербург, ул. Большая Конюшенная, д. 14

[email protected];

[email protected]



МО № 78

Ожогина Татьяна Александровна

Дружинина Юлия Николаевна


191023, Санкт‑Петербург, ул. Гороховая, д. 48

[email protected];

[email protected]



МО Литейный округ





191123, Санкт‑Петербург, ул. Фурштатская, д. 27 (муниципальный совет)

[email protected]






191187, Санкт‑Петербург, ул. Чайковского, д. 13 (местная администрация)

[email protected]


МО Смольнинское





191124, Санкт‑Петербург, Суворовский пр., д. 60

[email protected]



МО Лиговка-Ямская

Войтановский Вадим Николаевич




191024, Санкт‑Петербург, ул. Харьковская, д. 6/1

[email protected]; [email protected]



МО Владимирский округ

Тихоненко Денис Викторович

Небензя Павел Геннадьевич



191119, Санкт‑Петербург, ул. Правды, д. 12

[email protected]


Википедия — свободная энциклопедия

Избранная статья

Прохождение Венеры по диску Солнца — разновидность астрономического прохождения (транзита), — имеет место тогда, когда планета Венера находится точно между Солнцем и Землёй, закрывая собой крошечную часть солнечного диска. При этом планета выглядит с Земли как маленькое чёрное пятнышко, перемещающееся по Солнцу. Прохождения схожи с солнечными затмениями, когда наша звезда закрывается Луной, но хотя диаметр Венеры почти в 4 раза больше, чем у Луны, во время прохождения она выглядит примерно в 30 раз меньше Солнца, так как находится значительно дальше от Земли, чем Луна. Такой видимый размер Венеры делает её доступной для наблюдений даже невооружённым глазом (только с фильтрами от яркого солнечного света), в виде точки, на пределе разрешающей способности глаза. До наступления эпохи покорения космоса наблюдения этого явления позволили астрономам вычислить расстояние от Земли до Солнца методом параллакса, кроме того, при наблюдении прохождения 1761 года М. В. Ломоносов открыл атмосферу Венеры.

Продолжительность прохождения обычно составляет несколько часов (в 2004 году оно длилось 6 часов). В то же время, это одно из самых редких предсказуемых астрономических явлений. Каждые 243 года повторяются 4 прохождения: два в декабре (с разницей в 8 лет), затем промежуток в 121,5 года, ещё два в июне (опять с разницей 8 лет) и промежуток в 105,5 года. Последние декабрьские прохождения произошли 9 декабря 1874 года и 6 декабря 1882 года, а июньские — 8 июня 2004 года и 6 июня 2012 года. Последующие прохождения произойдут в 2117 и 2125 годах, опять в декабре. Во время прохождения наблюдается «явление Ломоносова», а также «эффект чёрной капли».

Хорошая статья

Резня в Благае (сербохорв. Масакр у Благају / Masakr u Blagaju) — массовое убийство от 400 до 530 сербов хорватскими усташами, произошедшее 9 мая 1941 года, во время Второй мировой войны. Эта резня стала вторым по счету массовым убийством после создания Независимого государства Хорватия и была частью геноцида сербов.

Жертвами были сербы из села Велюн и его окрестностей, обвинённые в причастности к убийству местного мельника-хорвата Йосо Мравунаца и его семьи. Усташи утверждали, что убийство было совершено на почве национальной ненависти и свидетельствовало о начале сербского восстания. Задержанных сербов (их число, по разным оценкам, составило от 400 до 530 человек) содержали в одной из школ Благая, где многие из них подверглись пыткам и избиениям. Усташи планировали провести «народный суд», но оставшаяся в живых дочь Мравунаца не смогла опознать убийц среди задержанных сербов, а прокуратура отказалась возбуждать дело против кого-либо без доказательства вины. Один из высокопоставленных усташей Векослав Лубурич, недовольный таким развитием событий, организовал новый «специальный суд». День спустя дочь Мравунаца указала на одного из задержанных сербов. После этого 36 человек были расстреляны. Затем усташи казнили остальных задержанных.

Изображение дня

Эхинопсисы, растущие на холме посреди солончака Уюни

участников — OpenVZ Virtuozzo Containers Wiki

Мы сделали эту страницу, чтобы собрать всех людей, которые внесли свой вклад в проект OpenVZ. Это никогда не может быть полный список, потому что люди помогают нам в разных областях: код, форум, инфраструктура, продвижение, поддержка и т. Д., И собрать их все будет сложно. Но мы изо всех сил стараемся это сделать.


  • 1 2015
    • 1,1 Качество
    • 1.2 Исходный код
    • 1.3 Поддержка
    • 1.4 Типовой проект
    • 1.5 Документация
    • 1.6 Зеркала
  • 2 2014
  • 3 2013
  • 4 2012
  • 5 2011
  • 6 2010
  • 7 2009
  • 8 2008
  • 9 2007
  • 10 2006
  • 11 См. Также

2015 [редактировать]


Спасибо всем репортерам об ошибках, отправившим сообщения об ошибках в 2015 году (59).

  • вилл 1977
  • VPSnet
  • Валентинр
  • вкулеш
  • тмин
  • Торвальдсон
  • Тимоти Редаэлли
  • Торстен
  • поддержка
  • Стефан Шлезингер
  • Шервин Даганато
  • Мамонов Сергей
  • Скотт Даудл
  • Сабина
  • Рене Докбуа
  • Куанг Фам
  • филл.bandelow
  • Одинцов Павел
  • Олег
  • nethubonline
  • Линас Жилинскас
  • Джо Догерти
  • Ярослав Марак
  • Гийом Лётчер
  • Гена Махомед
  • Fusl Dash
  • Девон
  • Крис Роу
  • Брэндон В.
  • Эшли Моравек
  • Андрей Татаранович
  • алкаид
  • Забиралов Александр Евгеньевич
Исходный код [править]

Спасибо всем, кто помог нам улучшить инструменты OpenVZ:

  • vzctl 4.9,3
    • Зак Померанц
  • vzctl 4.9.2
    • Линас Жилинскас
  • vzctl 4.9.1
    • М. Алхименко
    • Одинцов Павел
  • vzctl 4.9
    • Коршунов Сергей Яковлевич
    • Ави Брендер
    • Одинцов Павел
    • Огневский Денис
    • Пит Фостер
    • Цой Александр
    • Кевин Холли
    • Скотт Даудл
    • Рафаэль Гейссерт
    • Ола Лундквист
    • Дэниел Роббинс
    • nethubonline
    • Per Johansson
    • Александр Принсьер
    • Дмитрий В.Левин
    • Девон
    • toumin
  • ploop 1.14.1
    • Олег
  • участок 1.13.2
    • Андрей Татаранович
    • Роман Гахов
  • ploop 1.12.2
    • Мамонов Сергей
    • poiuty
Поддержка [править]
  • Кентаро Эбисава, который помог нам с стендом OpenVZ на саммите OpenStack в Токио
  • Скотт Даудл и другие, которые регулярно помогают пользователям OpenVZ в списке пользователей @ и IRC-канале
Дизайн [править]
  • Подрезов Федор
Документация [править]
  • Активных пользователей вики
  • Переводчики вики-страниц на другие языки.
Зеркала [править]
  • Сопровождающие зеркала загрузки OpenVZ. См. Полный список лиц и компаний, обслуживающих зеркала.

2014 [редактировать]

  • Отчеты об ошибках OpenVZ (281)
  • ploop 1.12.1
    • Коррадо Фиоре
    • Девон
  • участок 1.11
    • Виноградов Андрей
    • Майк Федык
    • Одинцов Павел
  • vzctl 4.8
    • Энтони Мун
    • Александр Иванишевич
    • Одинцов Павел
    • папарациз
    • Флориан Бантнер
    • Ионут Биру
    • Евгений Теречков
    • Кевин Холли
    • Стефан Эрикссон
    • Шон Фултон
    • Андрей Татаранович
  • vzctl 4.7.2
    • Александр Иванишевич
    • Павел Снайдр
    • Джастин Альбстмейер
  • vzctl 4.7
    • Шон Фултон
    • Подлесный Игорь
    • Майк Федык
    • Одинцов Павел
    • Донатас Абрайтис
    • редуктор
    • Оскар Грох
    • Дитмар Маурер
  • vzctl 4.6
    • Одинцов Павел
    • Майкл Реннер
    • Стефан Шлезингер
    • Поюты
    • Дэн Бассет
    • Ярослав Марак
    • Ола Лундквист
  • vzctl 4.5
    • Игорь Гнатенко
    • Марк МОРИС
    • Одинцов Павел
    • Дэн Бассет
    • Ола Лундквист
    • Георгий Каргиотакис
    • Покровительство;)
    • Альваро Поло
    • Слава Дубровский
  • vzctl 4.4
    • Андрей Вагин
    • Игорь Гнатенко
    • Одинцов Павел
    • Якуб Скокан
    • Джим Фолкнер
    • Василий Аверин
    • Лопо
    • Марио Кляйнзассер
    • Стефан Шлезингер
    • ховерхелл
    • maddinxxx
    • Михал Гасевич
    • mailinator
    • Марк МОРИС
  • vzctl 4.3.1
    • Андрей Вагин
    • dippo4589
  • vzctl 4.3
    • Глаубер Коста
    • Андрей Вагин
    • Подлесный Игорь
    • Simon Boulet
    • Роман Хефели
    • Paparaciz
    • Кнутов Ник
    • Константин Павлов
    • Калин Богатцевский
  • vzctl 4.2
    • Калин Богацевский
    • Антанас
    • Леонов Максим
    • Крис Батлер
    • Корнилов Андрей
    • Евгений Теречков
    • Глаубер Коста
    • Александр Иванишевич
    • Павел Снайдр
    • Джастин Альбстмейер
  • vzctl 4.1.2
    • Виноградов Андрей
    • Дастин Лундквист
  • vzstats 0.5.3
    • Ола Лундквист

2013 [редактировать]

  • Отчеты об ошибках OpenVZ (331)
  • ploop 1.8
    • Одинцов Павел
  • участок 1,9
    • Ола Лундквист
  • участок 1,10
    • Ола Лундквист
    • Стефан Шлезингер
    • Торстен Шиффердекер
    • Paparaciz
    • Одинцов Павел
    • Аарон М.Ucko
    • Blueicefield
  • ploop 1,7
    • Томас Лак
    • Калин Богацевский
  • участок 1.7.1
    • поюты
    • Виноградов Андрей
  • vzctl 4.6.1
    • Себастьян
    • Ола Лундквист
    • Тайлер Бишоп
    • лопо
  • vzstats 0.5.2
    • Павел Снайдр
    • Мирек Краточвил
  • vzstats 0.5.1
    • Одинцов Павел
  • взстат 0,5
    • ipredator.se
  • vzstats 0.4
    • Томас Лак (Удачливый)
    • CoolCold
  • vzstats 0.3.1
    • Марио Кляйнзассер
    • CoolCold
    • Paparaciz

2012 [редактировать]

  • Отчеты об ошибках OpenVZ (336)
  • ploop 1.1
    • jjs
  • ploop 1.4
    • Папарациз
  • vzctl 4.1.1
    • Ричард Х.
    • Рафаэль Гейссерт
    • Ола Лундквист
    • Одинцов Павел
    • Копытов Дмитрий
    • Торстен Шиффердекер
    • Мельников Максим
    • Андрей Вагин
    • Глаубер Коста
    • Paweł Tęcza
    • Андрес Тоомсалу
    • Давис
  • vzctl 4.1
    • Ричард Х.
    • Рафаэль Гейссерт
    • Ола Лундквист
    • Одинцов Павел
    • Копытов Дмитрий
    • Торстен Шиффердекер
    • Максим Мельников
    • Андрей Вагин
    • Глаубер Коста
    • Paweł Tęcza
    • Андрес Тоомсалу
    • Давис
  • vzctl 4.0
    • Глаубер Коста
    • солнечная
    • Выскребенцов Егор
    • Роман Каган
    • Дэниел Роббинс
    • mailinator
    • Одинцов Павел
    • Paparaciz
    • иен
    • Василий Куликов
    • Уильям Питкок
    • Бармалей
    • Калин Богацевский
  • vzctl 3.2.1
    • Ильяс
    • b294615
  • vzctl 3,2
    • Михаил Шигорин
    • Слава Дубровский
    • Артур Цихоцкий
    • кибернет
    • Антонис Христофидес
    • Борис
    • Тодд Мюллер
    • Илья Ливенсон
    • Paparaciz
    • Нильс Бройнезе
    • Роман (RXL_)
  • vzctl 3.1
    • Франк Вассмут
    • Марк Перкель
    • Михал Гжедзицки
    • Илья Ливенсон
    • Константин Хлебников
    • Одинцов Павел
    • samix_119
  • vzctl
    • Сергей Турчанинов
  • vzctl
    • Атро Тоссавайнен
  • vzctl 3.0.30
    • Джон О. Стивенс
    • Скотт Даудл
    • Ток Хойланд-Йоргенсен
    • Стефан Прибе
    • FabioDB
    • Тодд Мюллер
  • vzquota 3.1
    • Левин Дмитрий Валерьевич
    • Волков Петр
    • Питер Линнелл
    • Щелоков Максим

2011 [править]

  • vzctl 3.0.29
    • Тим Малый
    • Дитмар Маурер
    • Марио Кляйнзассер
    • Сэм Тренхольм
    • Слава Дубровский
    • Леандро Лопес
    • Скотт Даудл
  • vzctl
    • Уильям Тейлор
    • Даниэль Алдер
    • Ола Лундквист
  • Копытов Дмитрий
  • vzctl 3.0,29,2
    • Уильям Тейлор
    • Христо
    • Эрик
    • Томас Менари
    • Шваяков Александр
    • Щелоков Максим
  • vzctl
    • Скотт Даудл
    • Турчанинов Сергей
    • Харальд Каппер
    • Волков Петр
    • Ола Лундквист
    • Томас Менари
    • Слава Дубровский
  • vzctl 3.0.28
    • Брайан Мэй
    • Якуб Янковский
    • Дэниел Роббинс
    • Виктор Роман Арчидона
    • Дитмар Маурер
  • vzctl 3.0,27
    • Ола Лундквист
    • Дитмар Маурер
    • Епифанова Екатерина
    • Щелоков Максим
    • Андрей Вагин
    • Стефан Прибе
    • Торстен Шиффердекер
    • Кертис
    • Марк Перкель

2010 [редактировать]

  • vzctl
    • Дитмар Маурер
    • Бернд Ротерт
    • Ола Лундквист
    • Стефан Альфредссон
    • Овсяны Марчин
    • Хенк ван де Камер

2009 [редактировать]

  • vzctl 3.0,23
    • Левин Дмитрий Валерьевич
    • Джефф Блазиус
    • Бенуа Брансьяр
    • Ян Томашек
    • Дэниел Роббинс
    • Дэвид К
    • Алексис Херингер
    • Торстен Шиффердекер
    • Харальд Каппер
    • Дитмар Маурер
    • Овсяны Марчин
    • Бандан
    • Даниэль Халер
    • Роберт Нельсон
    • девушка
    • Волков Петр
    • тирукилл
    • Протопопов Антон

2008 [править]

2007 [править]

2006 [править]

  • Взносы 2006 года
    • Бенедикт Бём (а.к.а. Полый)
    • Кристиан Хайм (он же Фрик)
    • Кристиан Хёг
    • Торстен Шиффердекер
    • Левин Дмитрий Васильевич
    • Сергей Власов
    • Лепихов Константин Александрович
    • Джейсон Стаббс
    • Рик Бланделл

См. Также [редактировать]

  • Многие люди предоставили зеркала сайта загрузки OpenVZ. См. Зеркала загрузки для получения более подробной информации.
  • Статистика обновления
  • Участники Wiki

Этот сайт использует файлы cookie для повышения производительности.Если ваш браузер не принимает файлы cookie, вы не можете просматривать этот сайт.

Настройка вашего браузера для приема файлов cookie

Существует множество причин, по которым cookie не может быть установлен правильно. Ниже приведены наиболее частые причины:

  • В вашем браузере отключены файлы cookie. Вам необходимо сбросить настройки своего браузера, чтобы он принимал файлы cookie, или чтобы спросить вас, хотите ли вы принимать файлы cookie.
  • Ваш браузер спрашивает вас, хотите ли вы принимать файлы cookie, и вы отказались.Чтобы принять файлы cookie с этого сайта, нажмите кнопку «Назад» и примите файлы cookie.
  • Ваш браузер не поддерживает файлы cookie. Если вы подозреваете это, попробуйте другой браузер.
  • Дата на вашем компьютере в прошлом. Если часы вашего компьютера показывают дату до 1 января 1970 г., браузер автоматически забудет файл cookie. Чтобы исправить это, установите правильное время и дату на своем компьютере.
  • Вы установили приложение, которое отслеживает или блокирует установку файлов cookie.Вы должны отключить приложение при входе в систему или проконсультироваться с системным администратором.

Почему этому сайту требуются файлы cookie?

Этот сайт использует файлы cookie для повышения производительности, запоминая, что вы вошли в систему, когда переходите со страницы на страницу. Чтобы предоставить доступ без файлов cookie потребует, чтобы сайт создавал новый сеанс для каждой посещаемой страницы, что замедляет работу системы до неприемлемого уровня.

Что сохраняется в файле cookie?

Этот сайт не хранит ничего, кроме автоматически сгенерированного идентификатора сеанса в cookie; никакая другая информация не фиксируется.

Как правило, в файлах cookie может храниться только информация, которую вы предоставляете, или выбор, который вы делаете при посещении веб-сайта. Например, сайт не может определить ваше имя электронной почты, пока вы не введете его. Разрешение веб-сайту создавать файлы cookie не дает этому или любому другому сайту доступа к остальной части вашего компьютера, и только сайт, который создал файл cookie, может его прочитать.

Будущее глобальной финансовой системы: падение или гармония

В этой книге собраны лучшие доклады, представленные на конференции «Будущее глобальной финансовой системы: крушение или гармония», которая прошла в Лимассоле, Кипр, 13-14 апреля. , 2018.Конференция, организованная Институтом научных коммуникаций (Волгоград, Россия), в основном была посвящена переосмыслению роли и значения мировой финансовой системы в современной глобальной экономике в свете кризиса, который начался в 2008 году и все еще наблюдается во многих странах. , а также о разработке концептуальных и прикладных рекомендаций по стимулированию развития мировой финансовой системы.

Все работы прошли рецензирование и соответствуют строгим критериям, включая высокий уровень оригинальности (более 90%), элементы научной новизны, вклад в развитие экономической науки и широкие возможности для практического применения.Целевая аудитория данной научной работы — аспиранты, преподаватели высших учебных заведений, исследователи, изучающие современную мировую финансовую систему. Основываясь на выводах и результатах авторов, читатели будут иметь возможность проводить собственные научные исследования.

Рассматриваемые темы включают (но не ограничиваются ими) следующие вопросы, интересные для современной экономической науки и практики: финансовая глобализация, роль финансов в мировой экономике, перспективы перехода в финансовой системе со стороны инфраструктуры. новому вектору развития мировой экономики в 21 веке, причинам кризиса современной финансовой системы и путям его преодоления, проблемам и перспективам гармонизации мировой финансовой системы, а также сценариям развития мировой финансовой системы. система.Содержание разделено на следующие части: развитие финансовых систем на микро-, мезо- и макроуровнях, финансовая инфраструктура современной экономики, правовые вопросы развития современной финансовой системы и управление мировой финансовой системой.

Глобализация финансовой системы Глобальная экономика Денежный оборот Финансовый кризис Капитал Финансовая инфраструктура Финансовое регулирование Финансовый контроль Национальная финансовая система Глобальная финансовая система Финансовая и бюджетная стабилизация Инвестиции Международная торговля Развивающиеся страны Экономический рост Капитализация

%, если 0% {? Fedora}> = 27 || 0% {? Rhel}> 7 % глобальный py_prefix python3 % global py_binary% {py_prefix} %еще % глобальный py_prefix python % глобальный py_binary python2 % endif # При включенном annobin CRIU больше не работает.Кажется, CRIU # код паразита ломается, если включен annobin. % undefine _annotated_build Имя: criu Версия: 3.15 Релиз: 3% {? Dist} Предоставляет: crtools =% {version} -% {release} Вышло из употребления: crtools criu.8 Источник1: criu.8 Источник2: крит.1 Источник3: compel.1 # Патч aio-fix.patch необходим как RHEL7 # не выполняет «nr_events * = 2» в ioctx_alloc (). Патч200: aio-fix.patch % endif Источник4: criu-tmpfiles.conf BuildRequires: gcc BuildRequires: systemd BuildRequires: libnet-devel BuildRequires: protobuf-devel protobuf-c-devel% {py_prefix} -devel libnl3-devel libcap-devel % если 0% {? fedora} || 0% {? Rhel}> 7 BuildRequires: asciidoc xmlto BuildRequires: интерпретатор perl BuildRequires: libselinux-devel BuildRequires: gnutls-devel BuildRequires: nftables-devel # Для создания контрольных точек с помощью tmpfs требуется tar Рекомендует: tar % если 0% {? fedora} BuildRequires: libbsd-devel % endif % endif BuildRequires: сделать # изменения пользовательского пространства и ядра доступны только для x86_64, arm, # ppc64le, aarch64 и s390x # https: // bugzilla.redhat.com/show_bug.cgi?id=

  • 5 ExclusiveArch: x86_64% {arm} ppc64le aarch64 s390x %описание criu — это часть пользовательского пространства Checkpoint / Restore в пользовательском пространстве (CRIU), проект по реализации функции контрольной точки / восстановления для Linux в пользовательском пространстве. % если 0% {? fedora} % package devel Сводка: файлы заголовков и библиотеки для% {name} Требуется:% {name} =% {version} -% {release} % description devel Этот пакет содержит файлы заголовков и библиотеки для% {name}. % package libs Сводка: библиотеки для% {name} Требуется:% {name} =% {version} -% {release} % description libs Этот пакет содержит библиотеки для% {name} % endif % package -n% {py_prefix} -% {имя} % {? python_provide:% python_provide% {py_prefix} -% {name}} Обзор: привязки Python для% {name} % если 0% {? rhel} && 0% {? rhel} 7 сделать документы V = 1 % endif %установить make install-criu DESTDIR = $ RPM_BUILD_ROOT PREFIX =% {_ prefix} LIBDIR =% {_ libdir} make install-lib DESTDIR = $ RPM_BUILD_ROOT PREFIX =% {_ prefix} LIBDIR =% {_ libdir} PYTHON =% {py_binary} % если 0% {? fedora} || 0% {? Rhel}> 7 # устанавливайте документацию только на Fedora, поскольку для этого требуется asciidoc, # который недоступен на RHEL7 make install-man DESTDIR = $ RPM_BUILD_ROOT PREFIX =% {_ prefix} LIBDIR =% {_ libdir} %еще install -p -m 644 -D% {SOURCE1} $ RPM_BUILD_ROOT% {_ mandir} / man8 /% {name}.8 установить -p -m 644 -D% {SOURCE2} $ RPM_BUILD_ROOT% {_ mandir} /man1/crit.1 установить -p -m 644 -D% {SOURCE3} $ RPM_BUILD_ROOT% {_ mandir} /man1/compel.1 % endif mkdir -p% {buildroot}% {_ tmpfilesdir} install -m 0644% {SOURCE4}% {buildroot}% {_ tmpfilesdir} /% {name} .conf установить -d -m 0755% {buildroot} / run /% {name} / % если 0% {? rhel} # удалить пакеты devel и libs rm -rf $ RPM_BUILD_ROOT% {_ includedir} / criu rm $ RPM_BUILD_ROOT% {_ libdir} / *. так * rm -rf $ RPM_BUILD_ROOT% {_ libdir} / pkgconfig rm -rf $ RPM_BUILD_ROOT% {_ libexecdir} /% {имя} % endif # удалить статическую библиотеку rm -f $ RPM_BUILD_ROOT% {_ libdir} / libcriu.а % файлов % {_ sbindir} /% {name} % doc% {_ mandir} /man8/criu.8* % doc% {_ mandir} /man1/compel.1* % если 0% {? fedora} % {_ libexecdir} /% {имя} % endif % dir / run /% {имя} % {_ tmpfilesdir} /% {имя} .conf % doc README.md КОПИРОВАНИЕ % если 0% {? fedora} % files devel % {_ includedir} / criu % {_ libdir} / *. так % {_ libdir} / pkgconfig / *. pc % файлов библиотеки % {_ libdir} / *. итак. * % endif % files -n% {py_prefix} -% {имя} %, если 0% {? rhel} && 0% {? rhel} — 3.15–3 — Перестроен для https://fedoraproject.org/wiki/Fedora_34_Mass_Rebuild * Ср 13 января, 09:45:16 CET 2021 Адриан Ребер — 3.15-2 — Перестроен для protobuf 3.14 * Ср, 4 ноября 2020 г., Адриан Ребер — 3.15–1 — Обновление до 3.15 * Ср, 23 сентября 2020 г., Адриан Ребер — 3.14–8 — Перестроен для protobuf 3.13 * Пн, 27 июля 2020 г., Разработка релизов Fedora — 3.14-7 — Перестроен для https://fedoraproject.org/wiki/Fedora_33_Mass_Rebuild * Вт, 14 июля 2020 г., Джефф Лоу — 3.14-6 — Отключить LTO * Вс, 14 июня 2020 г., Адриан Ребер — 3.14–5 — Пересобран для protobuf 3.12 * Вт 26 мая 2020 Miro Hrončok — 3.14-4 — Перестроен для Python 3.9 * Чт, 30 апреля 2020 г., Адриан Ребер — 3.14-3 — BuildRequire nftables-devel для работы CI * Чт, 30 апреля 2020 г., Адриан Ребер — 3.14–2 — Восстановление для исправлений CI * Ср, 29 апреля 2020 г., Адриан Ребер — 3.14–1 — Обновление до 3.14 (# 1829399) * Вс 29 марта 2020 Андрей Вагин — 3.13-7 — Добавлен патч для gcc-10 * Вт, 28 января 2020 г., Разработка релиза Fedora — 3.13-6 — Перестроен для https://fedoraproject.org/wiki/Fedora_32_Mass_Rebuild * Пн, 16 сентября 2019 г., Адриан Ребер — 3.13–5 — Обновление до 3.13 (# 1751146) — Удалите обновленные патчи — Отбросить статическую библиотеку — Добавить обязательную man-страницу * Пн 19 августа 2019 Miro Hrončok — 3.12–14 — Перестроен для Python 3.8 * Ср, 24 июля 2019 г., Разработка релизов Fedora — 3.12-13 — Перестроен для https://fedoraproject.org/wiki/Fedora_31_Mass_Rebuild * Вт, 14 мая 2019 г., Адриан Ребер — 3.12–11 — Протестируйте другой файл решения в gating.yaml * Пн, 13 мая 2019 г., Адриан Ребер — 3.12-10 — Добавлены дополнительные исправления для маркировки сокетов. * Сб, 4 мая 2019 г., Адриан Ребер — 3.12–8 — Патч для маркировки сокетов изменен в восходящем направлении * Пн, 29 апреля 2019 г., Адриан Ребер — 3.12–4 — Применен патч для корректного восстановления socket () s * Сб, 27 апреля 2019 Адриан Ребер — 3.12-3 — Правильно исключить библиотеки и разработки для RHEL * Чт, 25 апреля 2019 г., Адриан Ребер — 3.12–2 — Обновлено до официальной 3.12 * Вт, 23 апреля 2019 г., Адриан Ребер — 3.12-0.1 — Обновлено до 3.12 (предварительная версия) — Создать подпакет libs — Сборка против SELinux (Fedora и RHEL8) — Сборка против libbsd (Fedora) * Чт, 31 января 2019 г., Разработка релиза Fedora — 3.11-3 — Перестроен для https://fedoraproject.org/wiki/Fedora_30_Mass_Rebuild * Сб, 19 января 2019 г., Адриан Ребер — 3.11–2 — Добавлен патч для gcc-9 * Вт, 06 ноября 2018 Адриан Ребер — 3.11-1 — Обновлено до 3.11 — Удалены обновленные патчи. * Вт, 30 октября 2018 г., Адриан Ребер — 3.10–5 — Добавлены рекомендации: tar Это необходимо при проверке контейнеров с помощью tmpfs. * Пн, 16 июля 2018 г., Адриан Ребер — 3.10–4 — Добавить патч для исправления ошибок с runc только для чтения * Чт, 12 июля 2018 г. Разработка релизов Fedora — 3.10–3 — Перестроен для https://fedoraproject.org/wiki/Fedora_29_Mass_Rebuild * 11 июля 2018 г., среда, Адриан Ребер — 3.10–2 — Отключить annobin, так как кажется, что он нарушает CRIU * Вт, 10 июля 2018 г. Адриан Ребер — 3.10-1 — Обновление до 3.10 (# 1599710) — Перейти на python3 * 6 июня 2018 г., среда, Адриан Ребер — 3.9: 2 — Упростите ExclusiveArch теперь, когда больше нет F26 * Пт, 1 июня 2018 г., Адриан Ребер — 3,9–1 — Обновление до 3.9 * Вт, 3 апреля 2018 г., Адриан Ребер — 3.8.1–1 — Обновление до 3.8.1 * Чт, 22 марта 2018 г., Адриан Ребер — 3,8–2 — Отбойник для COPR * Среда, 14 марта 2018 г., Адриан Ребер — 3,8: 1 — Обновление до 3.8 * Ср, 7 февраля 2018 г. Разработка релизов Fedora — 3.7–5 — Восстановлен для https://fedoraproject.org/wiki/Fedora_28_Mass_Rebuild * Сб 03.02.2018 Игорь Гнатенко — 3.7-4 — Перейти на %% ldconfig_scriptlets * Пт, 12 января 2018 г., Адриан Ребер — 3,7–3 — Исправить зависимости python / python2 во всех ветках * Ср, 3 января 2018 г., Мерлин Матесиус — 3,7–2 — Очистить условные обозначения файла спецификации * Сб, 30 декабря 2017 г., Адриан Ребер — 3,7: 1 — Обновление до 3.7 * Пт 15 декабря 2017 г. Ирина Щербина — 3,6–2 — Обновите объявления зависимостей Python 2 в соответствии с новыми стандартами упаковки. (См. Https://fedoraproject.org/wiki/FinalizingFedoraSwitchtoPython3) * Чт, 26 октября 2017 г., Адриан Ребер — 3,6: 1 — Обновите до 3.6 * 18 октября 2017 г., среда, Адриан Ребер — 3,5–5 — Добавлен патч для исправления сборки на Fedora rawhide aarch64. * Вт, 10 октября 2017 г., Адриан Ребер — 3,5–4 — Обновите импортированные страницы до 3.5. * Понедельник, 9 октября 2017 г., Адриан Ребер — 3,5–3 — Исправить ExclusiveArch на RHEL. * Пн, 2 октября 2017 г., Адриан Ребер — 3,5–2 — Объединить файл спецификации RHEL и Fedora * Чт, 28 сентября 2017 г., Адриан Ребер — 3,5: 1 — Обновление до 3.5 (# 1496614) * Вс, 27 августа 2017 г. Адриан Ребер — 3,4: 1 — Обновление до 3.4 (# 1483774) — Удалены обновленные патчи. — Добавлен s390x (# 1475719) * Сб, 19 августа 2017 г. Збигнев Енджеевски-Шмек — 3.3-5 — Бинарный пакет Python 2 переименован в python2-criu См. Https://fedoraproject.org/wiki/FinalizingFedoraSwitchtoPython3 * Ср, 2 августа 2017 г. Разработка релизов Fedora — 3.3–4 — Восстановлен для https://fedoraproject.org/wiki/Fedora_27_Binutils_Mass_Rebuild * Ср, 26 июля 2017 г. Разработка релизов Fedora — 3.3–3 — Перестроен для https://fedoraproject.org/wiki/Fedora_27_Mass_Rebuild * Чт, 20 июля 2017 г., Адриан Ребер — 3,3–2 — Добавлены патчи для обработки изменений в glibc. * 19 июля 2017 г., среда, Адриан Ребер — 3,3: 1 — Обновите до 3.3 * Пт, 30 июня 2017 г., Адриан Ребер — 3.2.1–2 — Добавлены патчи для обработки единой иерархии и нового glibc. * Среда, 28 июня 2017 г., Адриан Ребер — 3.2.1–1 — Обновление до 3.2.1-1 * Вт, 13 июня 2017 г., Орион Поплавски — 3.1–2 — Rebuild для protobuf 3.3.1 * Пн, 22 мая 2017 г., Адриан Ребер — 3,1–1 — Обновление до 3.1 * Вт, 25 апреля 2017 г., Адриан Ребер — 3,0: 1 — Обновление до 3.0 * Чт, 09 марта 2017 г., Адриан Ребер — 2.12: 1 — Обновление до 2.12 * Пт, 17 февраля 2017 г., Адриан Ребер — 2.11.1–1 — Обновление до 2.11.1 * Чт, 16 февраля 2017 г., Адриан Ребер — 2.11-1 — Обновление до 2.11 * 13 февраля 2017 г., Адриан Ребер — 2.10–4 — Добавлен патч для исправления сборки на ppc64le. * Пт, 10 февраля 2017 г. Разработка релиза Fedora — 2.10–3 — Перестроен для https://fedoraproject.org/wiki/Fedora_26_Mass_Rebuild * Пн, 23 января 2017 г., Орион Поплавски — 2.10–2 — Rebuild для protobuf 3.2.0 * Пн, 16 января 2017 г., Адриан Ребер — 2,10–1 — Обновление до 2.10 * Пн, 12 декабря 2016 г., Адриан Ребер — 2,9–1 — Обновление до 2.9 — Добавлена ​​страница руководства по критам в подпакет критов. * Сб, 19 ноября 2016 г. Орион Поплавски — 2,8–2 — Восстановить для protobuf 3.1.0 * Вт, 15 ноября 2016 г., Адриан Ребер — 2,8–1 — Обновление до 2.8 — Сброшен патч ‘mount_resolve_path ()’ * Ср, 19 октября 2016 г., Адриан Ребер — 2,7–2 — Добавлен апстрим патч для исправления # 1381351. («criu: mount_resolve_path (): криу убит SIGSEGV») * 19 октября 2016 г., среда, Адриан Ребер — 2,7: 1 — Обновление до 2.7 * Вт, 13 сентября 2016 г., Адриан Ребер — 2,6–1 — Обновление до 2.6 * Вт, 30 августа 2016 г., Адриан Ребер — 2,5–1 — Обновление до 2.5 * Вт, 19 июля 2016 г. Разработка релиза Fedora — 2.4–2 — https://fedoraproject.org/wiki/Changes/Automatic_Provides_for_Python_RPM_Packages * Вт, 12 июля 2016 г., Адриан Ребер — 2.4-1 — Обновление до 2.4 * Вт, 14 июня 2016 г., Адриан Ребер — 2.3: 1 — Обновление до 2.3 — Скопируйте man-страницу из Fedora 24 для RHEL * Пн, 23 мая 2016 г., Адриан Ребер — 2.2: 1 — Обновление до 2.2 * Вт, 12 апреля 2016 г., Адриан Ребер — 2,1–2 — Удалить символическую ссылку crtools * Пн, 11 апреля 2016 г., Адриан Ребер — 2,1–1 — Обновление до 2.1 * 6 апреля 2016 г., среда, Адриан Ребер — 2.0: 2 — Слияние изменений из Fedora * Чт 10 марта 2016 Андрей Вагин — 2.0: 1 — Обновление до 2.0 * Ср, 3 февраля 2016 г. Разработка релизов Fedora — 1.8–2 — Перестроен для https: // fedoraproject.org / wiki / Fedora_24_Mass_Rebuild * Пн, 7 декабря 2015 г., Адриан Ребер — 1,8–1 — Обновление до 1.8 * Пн, 2 ноября 2015 г., Адриан Ребер — 1.7.2–1 — Обновление до 1.7.2 * Пн 7 сентября 2015 Андрей Вагин — 1,7: 1 — Обновление до 1.7 * Чт 3 сентября 2015 Андрей Вагин — 1.6.1-3 — Сборка только для power64le * Чт 3 сентября 2015 Андрей Вагин — 1.6.1-2 — Сборка для aarch64 и power64 * 13 августа 2015 г., Адриан Ребер — 1.6.1–1 — Обновление до 1.6.1 — Слияние изменений для упаковки RHEL * Среда, 17 июня 2015 г. Разработка релизов Fedora — 1.6–2 — Перестроен для https: // fedoraproject.org / wiki / Fedora_23_Mass_Rebuild * Вт, 9 июня 2015 г., Адриан Ребер — 1,6–1,1 — адаптироваться к RHEL7 * Пн, 01 июня 2015 Андрей Вагин — 1,6-1 — Обновление до 1.6 * Чт 30 апреля 2015 Андрей Вагин — 1.5.2-2 — Требовать protobuf-python и python-ipaddr для python-criu * Вт 28 апреля 2015 Андрей Вагин — 1.5.2 — Обновление до 1.5.2 * Вс, 19 апреля 2015 Никита Спиридонов — 1.5.1-2 — Создание подпакетов python-criu и cris * Вт 31 марта 2015 Андрей Вагин — 1.5.1 — Обновление до 1.5.1 * Суббота, 6 декабря 2014 г., Адриан Ребер — 1,4–1 — Обновите до 1.4 * Вт, 23 сентября 2014 г., Адриан Ребер — 1.3.1-1 — Обновление до 1.3.1 (# 1142896) * Вт, 2 сентября 2014 г., Адриан Ребер — 1.3–1 — Обновление до 1.3 — Сброшены все обновленные патчи — включен файл pkgconfig в -devel * Сб, 16 августа 2014 г. Разработка релизов Fedora — 1.2–5 — Перестроен для https://fedoraproject.org/wiki/Fedora_21_22_Mass_Rebuild * 7 августа 2014 г., Андрей Вагин — 1.2–4 — Включите inttypes.h для помощников PRI * 7 августа 2014 г., Андрей Вагин — 1.2–3 — Перестроен для https://bugzilla.redhat.com/show_bug.cgi?id=1126751 * Сб, 7 июня 2014 г. Разработка релизов Fedora — 1.2-2 — Перестроен для https://fedoraproject.org/wiki/Fedora_21_Mass_Rebuild * Пт, 28 февраля 2014 г., Адриан Ребер — 1.2–1 — Обновление до 1.2 — Сброшены все обновленные патчи * Вт, 4 февраля 2014 г., Адриан Ребер — 1.1–4 — Создать подпакет -devel * Среда, 11 декабря 2013 г. Андрей Вагин — 1.0–3 — Исправить эпоху crtools * Вт, 10 декабря 2013 г. Андрей Вагин — 1.0-2 — Переименуйте crtools в criu # 1034677. * Ср, 27 ноября 2013 г. Андрей Вагин — 1.0-1 — Обновление до 1.0 * 24 октября 2013 г., Андрей Вагин — 0,8: 1 — Обновление до 0.8 * Вт 10 сентября 2013 Андрей Вагин — 0.7-1 — Обновление до 0.7 * Сб, 3 августа 2013 г. Разработка релизов Fedora — 0.6–5 — Перестроен для https://fedoraproject.org/wiki/Fedora_20_Mass_Rebuild * Ср, 24 июля 2013 г. Андрей Вагин — 0,6–3 — Удалите все параметры -fstack-protector gcc * Ср, 24 июля 2013 г. Андрей Вагин — 0,6–3 — Добавлен макрос руки в ExclusiveArch * Ср, 3 июля 2013 г. Андрей Вагин — 0,6–2 — исправить сборку на ARM — исправить разыменование нулевого указателя * Вторник, 2 июля 2013 г., Адриан Ребер — 0,6–1 — обновлено до 0.6 — апстрим переместил двоичные файлы в sbin — используя make install из апстрима * 14 мая 2013 г., Адриан Ребер — 0.5-1 — обновлено до 0.5 * Пт, 22 февраля 2013 г., Адриан Ребер — 0,4–1 — обновлено до 0.4 * Среда, 13 февраля 2013 г. Разработка релизов Fedora — 0.3–4 — Перестроен для https://fedoraproject.org/wiki/Fedora_19_Mass_Rebuild * Вт, 22 января 2013 г., Адриан Ребер — 0,3–3 — добавлен баг с блокировщиком ExclusiveArch * Пт, 18 января 2013 г., Адриан Ребер — 0,3–2 — улучшены Сводка и Описание * 14 января 2013 г., Адриан Ребер — 0,3: 1 — обновлено до 0.3 — исправить строительную документацию / * Вт, 21 августа 2012 г., Адриан Ребер — 0,2–2 — удалить макросы типа %% {__ mkdir_p} и %% {__ install} — добавить комментарий, почему только x86_64 * Вт 21 августа 2012 Адриан Ребер — 0.2-1 — изначальный выпуск

    Арктика — Википедия | WordDisk

    Arctic (или) [1] [Примечание 1] — это полярный регион, расположенный в самой северной части Земли. Арктика состоит из Северного Ледовитого океана, прилегающих морей и частей Аляски (США), Канады, Финляндии, Гренландии (Дания), Исландии, Норвегии, России и Швеции. Земля в арктическом регионе имеет сезонно меняющийся снежный и ледяной покров, преимущественно с вечной мерзлотой (вечной мерзлотой), содержащей тундру.Арктические моря во многих местах содержат сезонный морской лед.

    Полярная область северного полушария Земли

    Страны с сушей в пределах Арктического региона Местоположение Арктики Искусственно раскрашенная топографическая карта Арктического регионаMODIS image of Arctic

    Арктический регион является уникальным районом среди экосистем Земли. Культуры этого региона и коренные народы Арктики адаптировались к его холодным и экстремальным условиям. Жизнь в Арктике включает зоопланктон и фитопланктон, рыбу и морских млекопитающих, птиц, наземных животных, растения и человеческие сообщества.[3] Арктическая земля граничит с субарктикой.

    Определение и этимология

    Слово «Арктика» происходит от греческого слова ἀρκτικός ( arktikos ), «около медведя, северный» [4] и от слова ἄρκτος ( arktos ), что означает медведь. [5] Это название относится либо к созвездию Большой Медведицы, «Большая Медведица», которое выделяется в северной части небесной сферы, либо к созвездию Малой Медведицы, «Маленькая Медведица», которое содержит Полярную звезду, Полярную звезду, также известный как Полярная звезда.[6]

    Существует ряд определений того, какая территория находится в пределах Арктики. Район можно определить как к северу от Полярного круга (66 ° 33’N), приблизительную южную границу полуночного солнца и полярной ночи. Другое определение Арктики, популярное среди экологов, — это регион в Северном полушарии, где средняя температура самого теплого месяца (июль) ниже 10 ° C (50 ° F); крайняя северная линия деревьев примерно повторяет изотерму на границе этого региона.[7] [8]


    Для Арктики характерна холодная зима и прохладное лето. Осадки выпадают в основном в виде снега, и они невелики, при этом большая часть территории выпадает менее 50 см (20 дюймов). Сильный ветер часто поднимает снег, создавая иллюзию непрерывного снегопада. Средняя зимняя температура может опускаться до -40 ° C (-40 ° F), а самая низкая зарегистрированная температура составляет примерно -68 ° C (-90 ° F). Прибрежный арктический климат смягчается океаническими влияниями, поскольку обычно здесь более высокие температуры и более сильные снегопады, чем в более холодных и сухих внутренних районах.На Арктику влияет текущее глобальное потепление, ведущее к сокращению морского льда в Арктике, уменьшению ледяного покрова Гренландского ледяного щита и выбросу метана в Арктике по мере таяния вечной мерзлоты [9]. Таяние ледникового покрова Гренландии связано с усилением полярности [10].

    Из-за миграции изотерм планеты к полюсу (около 56 км (35 миль) за десятилетие в течение последних 30 лет как следствие глобального потепления) арктический регион (определяемый линией деревьев и температурой) в настоящее время сокращается.[11] Возможно, наиболее тревожным результатом этого является сокращение арктического морского льда. Прогнозы потери морского льда в Арктике сильно различаются: модели показывают от почти полной до полной потери в сентябре с 2035 года до примерно 2067 года. [12] [13]

    Флора и фауна

    Арктическая жизнь характеризуется адаптацией к короткому вегетационному сезону с продолжительным солнечным светом, а также к холодным, темным, заснеженным зимним условиям.

    Арктический мак в цвету в национальном парке Каусуиттук на острове Батерст

    Арктическая растительность состоит из таких растений, как карликовые кустарники, злаки, травы, лишайники и мхи, которые растут относительно близко к земле, образуя тундру.Примером карликового куста является толокнянка. По мере продвижения на север количество тепла, доступного для роста растений, значительно уменьшается. В самых северных областях растения находятся на пределе своего метаболизма, и небольшие различия в общем количестве летнего тепла сильно влияют на количество энергии, доступной для поддержания, роста и воспроизводства. Более холодные летние температуры приводят к уменьшению размеров, численности, урожайности и разнообразия растений. Деревья не могут расти в Арктике, но в ее самых теплых частях кусты обычны и могут достигать 2 м (6 футов 7 дюймов) в высоту; осоки, мхи и лишайники могут образовывать толстые слои.В самых холодных частях Арктики большая часть земли голая; Преобладают несосудистые растения, такие как лишайники и мхи, а также несколько отдельных трав и разнотравья (например, арктический мак).

    Овцебык Снежная сова

    Травоядные животные тундры включают арктического зайца, лемминга, овцебыка и карибу. На них охотятся полярная сова, песец, медведь гризли и полярный волк. Белый медведь также является хищником, но предпочитает охотиться на морских обитателей со льда. Есть также много птиц и морских видов, эндемичных для более холодных регионов.Другие наземные животные включают росомаху, лосей, овец Далла, горностаев и арктических сусликов. Морские млекопитающие включают тюленей, моржей и несколько видов китообразных — усатых китов, а также нарвалов, косаток и белух. Прекрасный и известный пример кольцевых видов существует и был описан за Полярным кругом в виде чаек Larus .

    Природные ресурсы

    Арктика включает в себя богатые природные ресурсы (нефть, газ, полезные ископаемые, пресная вода, рыба и, если включить Субарктику, лес), которым современные технологии и экономическая открытость России открыли новые значительные возможности.Интерес туристической индустрии также растет.

    В Арктике находятся одни из последних и наиболее обширных сплошных районов дикой природы в мире, и ее значение для сохранения биоразнообразия и генотипов очень велико. Растущее присутствие людей фрагментирует жизненно важные среды обитания. Арктика особенно восприимчива к истиранию почвенного покрова и нарушению редких мест размножения животных, характерных для этого региона. Арктика также содержит 1/5 запасов воды на Земле.[14]


    Морские окаменелости в канадской Арктике

    В течение мелового периода в Арктике все еще были сезонные снегопады, хотя только небольшое количество пыли и не было достаточным, чтобы постоянно препятствовать росту растений. Такие животные, как Chasmosaurus , Hypacrosaurus , Troodon и Edmontosaurus , возможно, мигрировали на север, чтобы воспользоваться преимуществами летнего вегетационного периода, а с наступлением зимы мигрировали на юг, в более теплые края. Похожая ситуация могла также быть обнаружена среди динозавров, которые жили в антарктических регионах, таких как Muttaburrasaurus из Австралии.

    Однако другие утверждают, что динозавры жили круглый год на очень высоких широтах, например, возле реки Колвилл, которая сейчас находится примерно на 70 ° северной широты, но в то время (70 миллионов лет назад) находилась на 10 ° севернее. [15]

    Коренное население

    Распределение населения циркумполярного побережья c. 2009 г. (включает коренное и некоренное население).

    Самые ранние жители центральной и восточной Арктики Северной Америки называются арктической традицией малых орудий (AST) и существовали ок.2500 г. до н.э. AST состояла из нескольких палеоэскимосских культур, включая культуры независимости и преддорсетскую культуру. [16] [17] Культура Дорсет (Inuktitut: Tuniit или Tunit ) относится к следующим обитателям центральной и восточной Арктики. Культура Дорсет эволюционировала в результате технологических и экономических изменений в период 1050–550 гг. До н. Э. За исключением полуострова Квебек / Лабрадор, культура Дорсет исчезла примерно в 1500 году нашей эры [18]. Подтвержденные генетическим тестированием, свидетельства показывают, что потомки культуры Дорсет, известные как Садлермиут, выжили на островах Айвилик, Саутгемптон и Коутс до начала 20 века.[19]

    Переход культур Дорсет / Туле датируется 9–10 веками нашей эры. Ученые предполагают, что, возможно, имел место перекрестный контакт двух культур с обменом технологиями, такими как изготовление голов для гарпунов, или Туле, возможно, нашли остатки Дорсет и адаптировались к культуре предшественников [20]. Другие считают, что Туле вытеснил Дорсет.

    К 1300 году нашей эры инуиты, современные жители Арктики и потомки культуры Туле, поселились на западе Гренландии и в течение следующего столетия перебрались в Восточную Гренландию (Инугуиты , Калааллит и Тунумиит — современные гренландские группы инуитов, происходящие от Туле. ).Со временем инуиты мигрировали по арктическим регионам Восточной России, США, Канаде и Гренландии [21].

    К другим коренным народам Приполярного Севера относятся чукчи, эвенки, инупиаты, ханты, коряки, ненцы, саамы, юкагиры, гвичины и юпики.

    Международное сотрудничество и политика

    Белые медведи на морском льду Северного Ледовитого океана, недалеко от Северного полюса. USS Honolulu На фото.

    Восемь арктических стран (Канада, Королевство Дания [Гренландия и Фарерские острова], Финляндия, Исландия, Норвегия, Швеция, Россия и США) являются членами Арктического совета, как и организации, представляющие шесть коренных народов.Совет действует на основе консенсуса, в основном занимаясь экологическими договорами, а не спорами о границах или ресурсах.

    Хотя приоритеты арктической политики различаются, каждая арктическая страна озабочена суверенитетом / обороной, освоением ресурсов, маршрутами судоходства и защитой окружающей среды. [22] Еще предстоит большая работа по нормативным соглашениям, касающимся судоходства, туризма и освоения ресурсов в арктических водах. [23]

    Исследования в Арктике уже давно являются совместными международными усилиями, о чем свидетельствует Международный полярный год.Международный комитет по арктической науке, сотни ученых и специалистов Арктического совета и Совет Баренцева / Евроарктического региона — еще больше примеров совместных международных исследований Арктики.

    Территориальные претензии

    Ни одна страна не владеет географическим Северным полюсом или окружающим его районом Северного Ледовитого океана. Окружающие шесть арктических государств, граничащих с Северным Ледовитым океаном — Канада, Королевство Дания (с Гренландией), Исландия, Норвегия, Россия и США — ограничены 200 морскими милями (370 км; 230 миль) исключительной экономической зоной ( EEZ) у их берегов.Два арктических государства (Финляндия и Швеция) не имеют прямого выхода в Северный Ледовитый океан.

    После ратификации Конвенции Организации Объединенных Наций по морскому праву у страны есть десять лет, чтобы предъявить претензии на расширенный континентальный шельф за пределами своей 200-мильной зоны. [22] [24] В связи с этим Норвегия (ратифицировавшая конвенцию в 1996 г.) [25] Россия (ратифицирована в 1997 г.) [25] Канада (ратифицирована в 2003 г.) [25] и Королевство Дания (ратифицирована в 2004 г.) [25] начали проекты, утверждающие, что определенные участки морского дна Арктики должны принадлежать их территориям.

    2 августа 2007 года два российских батискафа, МИР-1 и МИР-2, впервые в истории спустились на дно арктических морей под Северный полюс и поместили там российский флаг, сделанный из нержавеющего титанового сплава. Поднятие флага во время «Арктики-2007» вызвало беспокойство по поводу гонки за контроль над обширными углеводородными ресурсами Арктики. [26]

    Карта арктического региона с указанием Северо-Восточного прохода, Северного морского пути в нем и Северо-Западного прохода.

    Министры иностранных дел и другие официальные лица, представляющие Канаду, Королевство Дания, Норвегию, Россию и США, встретились в Илулиссате, Гренландия, 28 мая 2008 г. на конференции по Северному Ледовитому океану и объявили Илулиссатскую декларацию [27] [28], запрещающую любые «новый всеобъемлющий международно-правовой режим для управления Северным Ледовитым океаном» и обещание «упорядочить урегулирование любых возможных дублирующих требований.»[22] [29]

    С 2012 г. Королевство Дания претендует на континентальный шельф, основанный на хребте Ломоносова между Гренландией и над Северным полюсом до северной границы ИЭЗ России. [30]

    Российская Федерация также претендует на большую полосу морского дна вдоль хребта Ломоносова, но, в отличие от Дании, ограничила свои претензии своей стороной Арктики. В августе 2015 года Россия подала дополнительное представление о расширении внешних границ своего континентального шельфа в Северном Ледовитом океане, утверждая, что восточная часть хребта Ломоносова и хребта Менделеева являются продолжением Евразийского континента.В августе 2016 года Комиссия ООН по границам континентального шельфа начала рассмотрение предложения России [31].

    Канада заявляет, что Северо-Западный проход является частью своих внутренних вод, принадлежащих Канаде, в то время как Соединенные Штаты и большинство морских стран [32] рассматривают его как международный пролив, что означает, что иностранные суда имеют право транзитного прохода. [33]


    С 1937 года большая часть азиатского арктического региона активно исследуется советскими и российскими пилотируемыми дрейфующими ледовыми станциями.В период с 1937 по 1991 год 88 международных полярных экипажей основали и заняли научные поселения на дрейфующем льду и были перенесены потоком льда на тысячи километров [34].

    Пути загрязнения на большие расстояния в Арктику

    Арктика относительно чиста, хотя существуют определенные экологически сложные локальные проблемы загрязнения, которые представляют серьезную угрозу для здоровья людей, живущих вокруг этих источников загрязнения. В связи с преобладающими во всем мире морскими и воздушными течениями арктический регион является районом выпадений загрязнителей, переносимых на большие расстояния, а в некоторых местах их концентрации превышают уровни густонаселенных городских районов.Примером этого является явление арктической дымки, в котором обычно виноваты загрязнители, расположенные на больших расстояниях. Другой пример — биоаккумуляция ПХБ (полихлорированных дифенилов) в дикой природе и людях Арктики.


    На протяжении многих лет было много предложений по сохранению Арктики. Совсем недавно группа звезд на Саммите Земли в Рио, 21 июня 2012 года, предложила защитить Арктику, подобно защите Антарктики. Первоначально в центре внимания кампании будет резолюция ООН о создании всемирного заповедника вокруг полюса, а также запрет на бурение нефтяных скважин и неустойчивое рыболовство в Арктике.[35]

    Глобальное потепление

    Последствия глобального потепления в Арктике включают повышение температуры, потерю морского льда и таяние ледяного покрова Гренландии. Возможный выброс метана из региона, особенно в результате таяния вечной мерзлоты и клатратов метана, также вызывает озабоченность. Из-за усиленной реакции Арктики на глобальное потепление ее часто считают ведущим индикатором глобального потепления. Таяние ледникового покрова Гренландии связано с усилением полярных полей.[36] [37]

    Площадь морского льда в Арктике по состоянию на 2007 г. по сравнению с 2005 г. и по сравнению со средним показателем 1979–2000 гг.

    Арктика особенно уязвима к последствиям любых климатических изменений, что стало очевидным с сокращением площади морского льда в последние годы. Климатические модели предсказывают гораздо более сильное потепление в Арктике, чем в среднем по миру [38], в результате чего региону уделяется значительное внимание со стороны международного сообщества. В частности, есть опасения, что сокращение Арктики в результате таяния ледников и других льдов в Гренландии может вскоре способствовать значительному повышению уровня моря во всем мире.[39]

    Текущее потепление в Арктике приводит к тому, что древний углерод выделяется из тающей вечной мерзлоты, что приводит к производству метана и углекислого газа микроорганизмами. [40] [41] Выброс метана и углекислого газа, хранящихся в вечной мерзлоте, может вызвать резкое и серьезное глобальное потепление [42], поскольку они являются мощными парниковыми газами. [43]

    Также прогнозируется, что изменение климата окажет большое влияние на растительность тундры, вызывая рост кустарников [44] и оказывая негативное воздействие на мохообразные и лишайники.[45]

    Помимо опасений по поводу пагубных последствий потепления в Арктике, внимание привлекли некоторые потенциальные возможности. Таяние льда делает Северо-Западный проход, судоходные пути через самые северные широты, более судоходными, что повышает вероятность того, что арктический регион станет основным торговым маршрутом. [46] Одним из предвестников открытия судоходства в Арктике стало лето 2016 года, когда «Кристальная безмятежность» успешно прошла Северо-Западный проход, впервые для большого круизного лайнера.[47] Кроме того, считается, что арктическое морское дно может содержать значительные нефтяные месторождения, которые могут стать доступными, если покрывающий их лед тает. [48] Эти факторы привели к недавним международным дебатам относительно того, какие страны могут претендовать на суверенитет или владение водами Арктики. [49] [50] [51] [52]

    Эйдс-фьорд в Вестеролене, Норвегия, находится в 250 км (160 миль) за Полярным кругом, но в сравнительно умеренном норвежском море средняя годовая температура составляет 4 ° C (39 ° F), а трехмесячное лето выше 10 ° C.[53]

    Арктические воды

    Арктические земли

    Остров Баффинова Земля Остров Уумманнак, Гренландия Ненецкие оленеводы в Ямало-Ненецком автономном округе Коцебу, Аляска

    См. Также


    1. Первоначально слово произносилось без звука / k /, но в настоящее время очень распространено произношение со звуком k. Буква «с» была добавлена ​​к написанию по этимологическим причинам [1] [2], а затем стала произноситься, но (как и в случае с другим орфографическим произношением) сначала только менее образованными людьми.

    Список литературы

    1. Компания, Houghton Mifflin Harcourt Publishing. «Словарь американского наследия: арктика». www.ahdictionary.com . Архивировано 12 июня 2018 года. Проверено 4 января 2019 года.
    2. Harper, Douglas. «Антарктика». Интернет-словарь этимологии . Проверено 16 ноября 2011 года.
    3. Кристофер Крембс и Джоди Деминг. «Организмы, которые процветают во льдах Арктики». Национальное управление океанических и атмосферных исследований.18 ноября 2006 г.
    4. Лидделл, Генри Джордж и Скотт, Роберт. «Арктикос». Греко-английский лексикон . Цифровая библиотека Персея.
    5. Лидделл, Генри Джордж и Скотт, Роберт. «Арктос». Греко-английский лексикон . Цифровая библиотека Персея.
    6. «Созвездие Большой Медведицы Большая Медведица». Архивировано 30 ноября 2010 года. Проверено 10 ноября 2010 года.
    7. «arctic». Dictionary.com Unabridged (версия 1.1). Random House, Inc.Проверено 2 мая 2009 г.
    8. Addison, Kenneth (2002). Основы физической среды . Рутледж. п. 482. ISBN 978-0-415-23293-7 .
    9. Рэдфорд, Тим (2 сентября 2020 г.). «Прогрев Арктики опережает худшие прогнозы». Сеть климатических новостей . Проверено 3 сентября 2020 г.
    10. Tedesco, M .; Mote, T .; Fettweis, X .; Hanna, E .; Jeyaratnam, J .; Бут, Дж. Ф .; Datta, R .; Бриггс, К. (9 июня 2016 г.).«Арктический предел отсечки приводит к сдвигу к полюсу нового рекорда таяния Гренландии». Nature Communications . 7 : 11723. Bibcode: 2016NatCo … 711723T. DOI: 10,1038 / ncomms11723. ISSN 2041-1723. PMC 4
    11. 3. PMID 27277547.
    12. Хансен, Джим (19 октября 2006 г.). «Планета в опасности — Часть I». Йельский центр изучения глобализации. Архивировано 15 октября 2009 года.
    13. Кирби, Алекс (11 августа 2020 года). «Исчезновение морского льда в Арктике к 2035 году возможно, — показывают исследования». Сеть климатических новостей . Проверено 3 сентября 2020 г.
    14. Рейх, Кэтрин (15 ноября 2019 г.). «Северный Ледовитый океан может быть свободным ото льда в течение части года уже к 2044 году». Phys.org . Проверено 3 сентября 2020 г.
    15. Общество, National Geographic (6 октября 2016 г.). «Арктический». Национальное географическое общество . Проверено 11 июня 2020 года.
    16. «Приключение палеонтологов на Аляске». Новый ученый . 9 июня 2012 г.
    17. Хоффекер, Джон Ф. (2005). Предыстория севера: поселение людей в высоких широтах . Издательство Университета Рутгерса. п. 130. ISBN 978-0-8135-3469-5 .
    18. Гиббон, стр. 28–31
    19. Гиббон, стр. 216–217
    20. МакГи, Роберт (2005). Последнее воображаемое место: человеческая история арктического мира (Оцифровано 7 октября 2008 г.). Издательство Оксфордского университета. п. 55. ISBN 978-0-19-518368-9 .
    21. Гиббон, стр. 218
    22. «Индекс культур коренных народов». Канадский музей цивилизации .
    23. Buixadé Farré, Albert; Стивенсон, Скотт Р .; Чен, Линлинг; Чуб, Майкл; Дай, Инь; Демчев, Денис; Ефимов, Ярослав; Грачик, Петр; Грит, Хенрик; Кейл, Катрин; Кивекяс, Нику; Кумар, Нареш; Лю, Ненгье; Мателенок, Игорь; Мыксволл, Мари; О’Лири, Дерек; Олсен, Джулия; Павитран, А.П., Сачин; Петерсен, Эдвард; Распотник, Андреас; Рыжов, Иван; Сольски, Ян; Суо, Линглинг; Троен, Кэролайн; Валеева, Вилена; ван Райкеворсель, Яап; Уайтинг, Джонатан (16 октября 2014 г.).«Коммерческое арктическое судоходство через Северо-восточный проход: маршруты, ресурсы, управление, технологии и инфраструктура». Полярная география . 37 (4): 298. DOI: 10.1080 / 1088937X.2014.965769.
    24. Беркман, Пол (23 июня 2014 г.). «Стабильность и мир в Северном Ледовитом океане через научную дипломатию». Наука и дипломатия . 3 (2).
    25. «Конвенция Организации Объединенных Наций по морскому праву (Приложение 2, статья 4)».Архивировано 16 июля 2007 года. Проверено 26 июля 2007 года.
    26. «Хронологические списки ратификаций, присоединений и правопреемств к Конвенции и связанным с ней соглашениям». Отдел ООН по вопросам океана и морскому праву. 22 апреля 2009 г. Архивировано 14 апреля 2009 г. Проверено 30 апреля 2009 г.
    27. Еникеев, С. М. и Фентон Крысиек, Тимоти (август 2007 г.). Битва за новый энергетический рубеж: Российская полярная экспедиция и будущее арктических углеводородов .Оксфордский институт энергетических исследований.
    28. «Конференция в Илулиссате, Гренландия: знаменательная политическая декларация о будущем Арктики». Министерство иностранных дел Дании. 28 мая 2008 г. Проверено 30 апреля 2009 г. [ мертвая ссылка ]
    29. «Илулиссатская декларация» (PDF). Министерство иностранных дел Дании. 28 мая 2008 г. Архивировано из оригинала (PDF) 26 июня 2008 г. Дата обращения 6 июня 2008 г.
    30. Boswell, Randy (28 мая 2008 г.).«Конференция может ознаменовать начало арктической борьбы за власть». canada.com. Архивировано 4 марта 2009 года. Проверено 6 июня 2008 года.
    31. «Dansker vil dokumentere Territorialkrav i Arktis» (на норвежском языке). NRK. 28 июля 2012 г. Дата обращения 15 июня 2015 г.
    32. «Россия подает заявку на расширение датских границ на арктическом шельфе». 23 января 2017 г.
    33. The Edmonton Journal (9 апреля 2006 г.). «Северо-Западный проход меняет политическое название».Canada.com. Архивировано 2 апреля 2016 года. Проверено 31 мая 2015 года.
    34. «США вступают в драку с Канадой из-за таяния арктического судоходного маршрута». Кварц . 27 июня 2019 г.
    35. «Дрейфующие станции Северного полюса (1930–1980-е годы)». Океанографическое учреждение Вудс-Хоул. Проверено 30 апреля 2009 г.
    36. Stars запускают кампанию по спасению Арктики. Гринпис (21 июня 2012 г.).
    37. Исследование связывает таяние льдов Гренландии в 2015 г. с ускорением потепления в Арктике 9 июня 2016 г. Университет Джорджии
    38. Tedesco, M.; Mote, T .; Fettweis, X .; Hanna, E .; Jeyaratnam, J .; Бут, Дж. Ф .; Datta, R .; Бриггс, К. (2016). «Арктический предел отсечки приводит к сдвигу к полюсу нового рекорда таяния Гренландии». Nature Communications . 7 : 11723. Bibcode: 2016NatCo … 711723T. DOI: 10,1038 / ncomms11723. PMC 4
    39. 3. PMID 27277547.
    40. Воздействие потепления Арктики: оценка воздействия на климат Арктики . Кембридж, Великобритания: Издательство Кембриджского университета. Февраль 2005 г. doi: 10.2277 / 0521617782 (неактивен 15 января 2021 г.).ISBN 978-0-521-61778-9 . Проверено 20 ноября 2006 г. CS1 maint: DOI неактивен с января 2021 г. (ссылка)
    41. Grinberg, Emanuella (17 декабря 2008 г.). «Лед тает по всему миру с ускорением, — заявляет НАСА». CNN.
    42. Lenton, T.M .; Held, H .; Kriegler, E .; Холл, J.W .; Lucht, W .; Rahmstorf, S .; Шеллнхубер, Х.Дж. (2008). «Вступительная статья: Опрокидывающие элементы в климатической системе Земли». Proceedings of the National Academy of Sciences . 105 (6): 1786–93.Bibcode: 2008PNAS..105.1786L. DOI: 10.1073 / pnas.0705414105. PMC 2538841. PMID 18258748.
    43. Турецкий, Мерритт Р. (30 апреля 2019 г.). «Обрушение вечной мерзлоты ускоряет выброс углерода». Природа . 569 (7754): 32–34. Бибкод: 2019Natur.569 … 32T. DOI: 10.1038 / d41586-019-01313-4. PMID 31040419.
    44. «Резкое изменение климата в центре внимания национальных лабораторий США». Science Daily . 23 сентября 2008 г.
    45. Reuters (18 июня 2019 г.).«Ученые шокированы таянием вечной мерзлоты в Арктике на 70 лет раньше, чем предполагалось». Гардиан . ISSN 0261-3077. Проверено 2 июля 2019 г.
    46. Myers-Smith, Isla H .; Форбс, Брюс С .; Уилмкинг, Мартин; Холлинджер, Мартин; Ланц, Тревор; Блок, Даан; Лента, Кен Д .; Масиас-Фаурия, Марк; Сасс-Клаассен, Юте (1 января 2011 г.). «Распространение кустарников в тундровых экосистемах: динамика, влияние и приоритеты исследований». Письма об экологических исследованиях . 6 (4): 045509.Bibcode: 2011ERL ….. 6d5509M. DOI: 10.1088 / 1748-9326 / 6/4/045509. ISSN 1748-9326.
    47. Alatalo, Juha M .; Jägerbrand, Annika K .; Молау, Ульф (1 ноября 2015 г.). «Проверка надежности краткосрочных ответов для прогнозирования долгосрочных реакций мохообразных и лишайников на изменение окружающей среды». Экологические показатели . 58 : 77–85. DOI: 10.1016 / j.ecolind.2015.05.050.
    48. «Лед растает в легендарном Северо-Западном проходе?» Архивировано 9 ноября 2007 года в Wayback Machine CNN.29 августа 2002 г.
    49. «Самый большой круизный лайнер, когда-либо курсировавший в доках Северо-Западного прохода в Нью-Йорке». 16 сентября 2016 г. Проверено 24 сентября 2016 г.
    50. Demos, Telis. «Великая нефтяная лихорадка за полярным кругом». CNN. 8 августа 2007 г.
    51. Шоу, Роб. «Новые патрульные корабли подтвердят суверенитет Севера: ПМ». Колонист Виктория Таймс. 9 июля 2007 г.
    52. Хэлпин, Тони. «Россия делает ставку на Северный полюс в поисках нефти под водой». Таймс . 28 июля 2007 г.
    53. «Таяние Арктики потрясает ученых». CBS News . 9 октября 2007 г. [ постоянная мертвая связь ]
    54. «Конференция может ознаменовать начало арктической борьбы за власть». Canada.com. 28 мая 2008 г. Архивировано 4 марта 2009 г.
    55. Стокмаркнес в Вестеролене в среднем за 1961–1990 годы. Retro.met.no (28 января 2008 г.). Проверено 18 октября 2011.


    Дополнительная литература

    • Брайан У.Коад, Джеймс Д. Рейст. (2017). Морские рыбы Арктической Канады . Университет Торонто Пресс. ISBN 978-1-4426-4710-7
    • «Глобальная безопасность, изменение климата и Арктика» — 24-страничный специальный выпуск журнала (осень 2009 г.), Swords and Pllowshares , Программа по контролю над вооружениями, разоружению и международной безопасности (ACDIS), Университет Иллинойса
    • GLOBIO Карты воздействия человека Отчет о воздействии человека на Арктику
    • Крупник Игорь Михайлович А.Ланг и Скотт Миллер, ред. Смитсоновский институт на полюсах: вклад в науку Международного полярного года. Вашингтон, округ Колумбия: Scholarly Press Смитсоновского института, 2009.
    • Валерий Конышев, Александр Сергунин: Арктика на перекрестке геополитических интересов Российская политика и право, 2012, том 50, № 2, стр. 34–54
    • Капюля, Юха и Миккола, Харри: Глобальная Арктика: растущие интересы России, Китая, США и Европейского Союза в Арктике, Информационный доклад FIIA 133, август 2013 г., Финский институт международных отношений.
    • Конышев Валерий и Сергунин Александр. Арктика на перекрестке геополитических интересов // Российская политика и право, 2012. Vol. 50, № 2. с. 34–54
    • Конышев, Валерий и Сергунин, Александр: Является ли Россия ревизионистской военной силой в Арктике? Анализ обороны и безопасности, сентябрь 2014 г.
    • Конышев Валерий и Сергунин Александр. Россия в поисках своей арктической стратегии: между жесткой и мягкой силой? Полярный журнал, апрель 2014 г.
    • Макканнон, Джон. История Арктики: природа, исследование и освоение . Reaktion Books и University of Chicago Press, 2012. ISBN 9781780230184
    • О’Рурк, Рональд (14 октября 2016 г.). Изменения в Арктике: история вопроса и проблемы для Конгресса (PDF). Вашингтон, округ Колумбия: Исследовательская служба Конгресса. Проверено 20 октября 2016 года.
    • Сперри, Армстронг (1957). Все об Арктике и Антарктике . Случайный дом. LCCN 57007518.

    Измерение смещения размера иллюминации с помощью REcount: новый метод высокоточной количественной оценки созданных генетических конструкций


    Количественная оценка тегов последовательностей ДНК, связанных с созданными генетическими конструкциями, лежит в основе многих геномных измерений.Обычно такие измерения выполняются с использованием ПЦР для обогащения тегов последовательностей и добавления адаптеров с последующим секвенированием следующего поколения (NGS). Однако амплификация ПЦР может внести значительную количественную ошибку в эти измерения. Здесь мы описываем REcount, новый метод прямого подсчета без ПЦР для количественной оценки созданных генетических конструкций на основе NGS. Сравнивая измерения определенных пулов плазмид с данными цифровой ПЦР капель, мы демонстрируем, что этот метод является очень точным и воспроизводимым.Мы также демонстрируем, что подход REcount поддается мультиплексированию за счет использования ортогональных рестрикционных ферментов. Наконец, мы используем REcount, чтобы по-новому взглянуть на ошибки кластеризации из-за длины молекулы на различных платформах секвенирования Illumina.


    Сконструированные генетические конструкции лежат в основе многих экспериментальных методов в генетике и геномике. Например, целенаправленное нарушение функции гена с использованием РНК-интерференции или CRISPR / Cas9 позволяет проводить объединенные генетические скрининги по всему геному, которые можно считывать с помощью секвенирования следующего поколения (NGS) малой шпилечной РНК (shRNA) (Sims et al.2011; Родригес-Барруэко и др. 2013) или синтетические направляющие РНК (sgRNA) (Wang et al.2014; Koike-Yusa et al. 2014; Shalem et al. 2014, 2015) конструкции или связанные с ними теги / штрих-коды последовательностей (Smith et al. 2009). Мобильные элементы также обычно используются для мутации или иного манипулирования генетическими локусами и аналогичным образом позволяют проводить экраны мутагенеза насыщения в масштабе генома, в которых соединение транспозон-геном измеряется с помощью NGS (van Opijnen and Camilli 2013). Отслеживание происхождения (Bhang et al., 2015; McKenna et al.2016) и коннектомика (Kebschull et al. 2016; Peikon et al. 2017) также полагаются на количественную оценку молекулярных меток на основе NGS. Во всех этих подходах амплификация с помощью полимеразной цепной реакции (ПЦР) используется для обогащения тегов последовательностей и добавления адаптеров и других функций (например, штрих-кодов для конкретных образцов), необходимых для секвенирования. Однако ПЦР вносит систематическую ошибку в эти измерения. Метки последовательности, состоящие из shRNA, sgRNA, соединений транспозон: геном или синтетических штрих-кодов, могут отличаться по первичной последовательности и биофизическим свойствам, которые, наряду с другими переменными, такими как концентрация матрицы и условия ПЦР, могут влиять на эффективность амплификации непредсказуемым образом (Aird и другие.2011; Gohl et al. 2016; Strezoska et al. 2012). Добавление уникальных молекулярных идентификаторов (UMI) может смягчить некоторые из этих предубеждений, но увеличивает сложность как подготовки библиотеки, так и анализа (Kivioja et al. 2011; Kinde et al. 2011). Другие подходы, такие как капельная цифровая ПЦР (ddPCR) и анализ NanoString, могут использоваться для преодоления количественных неточностей, связанных с измерением сконструированных генетических конструкций, но им не хватает пропускной способности и разрешения, обеспечиваемых NGS (Geiss et al. 2008; Hindson et al.2011).

    Мы разработали новый метод REcount ( R estriction E nzyme enabled count ing) для количественной оценки тегов последовательностей, связанных со сконструированными генетическими конструкциями, который прост в реализации и позволяет проводить прямой подсчет на основе NGS потенциально возможных огромное количество тегов последовательности. В этом подходе штрих-код ДНК, фланкированный адаптером Illumina, высвобождается путем переваривания с помощью M / y I (фермент рестрикции типа IIS, который производит молекулы с тупыми концами) и секвенируется для прямого подсчета количества молекул-матрицы (рис. 1A).Мы используем REcount для разработки набора синтетических стандартов ДНК, которые можно использовать для оценки систематической ошибки кластеризации из-за длины молекулы на секвенаторах Illumina, и демонстрируем, что существует значительная разница в размере систематической ошибки между различными инструментами Illumina.

    Рис. 1. REcount позволяет проводить точные и точные измерения пулов плазмид.

    А) Дизайн конструкций REcount. Содержащую штрих-код конструкцию Illumina с фланкированным адаптером высвобождают с помощью расщепления рестрикционным ферментом ( M / y I) и непосредственно секвенируют.Б) Точность и воспроизводимость REcount. C) Аналогичные измерения того же пула плазмид, показанные на панели B, с использованием различных номеров циклов ПЦР. D) Среднеквадратичное отклонение корня от ожидаемых значений (5% на конструкцию) при измерении пула плазмид с использованием REcount и различных циклов ПЦР-амплификации либо конструкции штрих-кода (BC), либо другой вариабельной последовательности в этих плазмидах (V4). E) Корреляционная тепловая карта Пирсона, сравнивающая измерения REcount с данными цифровой ПЦР капель и с традиционной ПЦР-амплификацией ампликонов BC или V4.


    Чтобы охарактеризовать метод REcount, мы создали пул из 20 синтетических плазмид, содержащих штрих-коды REcount, смешанных в эквимолярном количестве (5% на плазмиду) на основе измерений флуорометрической концентрации ДНК. Этот пул расщепляли M / y I и секвенировали на Illumina MiSeq. Все 20 штрих-кодов были обнаружены при относительной численности от 3,41% до 6,32% (CV = 0,13), что соответствует целевому количеству 5% на конструкцию (дополнительный рисунок S1).Чтобы создать более точно объединенный эталонный стандарт для последующих экспериментов, мы использовали эти данные секвенирования в качестве основы для повторного объединения 20 плазмид и расщепили новый пул с помощью M / y I и секвенировали. Диапазон относительных количеств повторно объединенных плазмид был более узким и составлял от 4,52% до 5,58% (CV = 0,06), что указывает на то, что исходные данные секвенирования были предсказуемыми для повышения точности объединения по оценке REcount (дополнительный рисунок S1) . Чтобы оценить воспроизводимость этих измерений, мы расщепили и секвенировали две дополнительные реплики четного пула плазмид.Повторные измерения REcount были хорошо воспроизводимы со средним CV 0,02 (рис. 1B).

    Дополнительная фигура 1. Исходные и повторно объединенные данные пула плазмид.

    REcount измерения первоначальной попытки равномерного объединения плазмид на основе данных PicoGreen и последующего повторного объединения на основе данных первоначального секвенирования пула.

    Затем мы сравнили измерения REcount четного пула плазмид с измерениями на основе ПЦР либо конструкции штрих-кода (BC), либо последовательности, специфичной для другой конструкции (V4).Измерения на основе ПЦР показали существенные конструктивные отклонения от ожидаемых 5% значений, степень которых увеличивалась с увеличением числа циклов ПЦР (рис. 1C-0). Кроме того, конструктивные отклонения от ожидаемых значений не коррелировали для измерений ампликонов BC и V4, что позволяет предположить, что смещения PCR были функцией последовательности матрицы (дополнительный рисунок S2).

    Дополнительный рисунок 2. Отсутствие корреляции между BC и V4 PCR.

    Диаграммы рассеяния данных по содержанию BC и V4 для пула четных плазмид при амплификации для A) 10, B) 20, C) 30 или D) 40 циклов ПЦР.

    Чтобы независимо измерить относительные концентрации матрицы в четном пуле плазмид, мы разработали пару анализов ddPCR, нацеленных на каждую конструкцию штрих-кода, и подтвердили специфичность каждого анализа с помощью qPCR на каждой из 20 отдельных плазмидных матриц (дополнительный рисунок S3) (Хиндсон и др., 2011). Измерения на основе ddPCR хорошо коррелировали с измерениями REcount как для исходных, так и для повторно объединенных пулов плазмид (рисунок 1E, дополнительный рисунок S3). Напротив, основанные на ПЦР измерения ампликонов BC и V4 не были хорошо коррелированы с измерениями ddPCR (рисунок 1E, дополнительный рисунок S3).Эти результаты были подтверждены аналогичными измерениями пула тех же 20 плазмид, смешанных в шахматном порядке, где измерения на основе ПЦР снизили корреляцию с измерениями ddPCR и привели к систематической переоценке конструкций с более низким содержанием (дополнительный рисунок S4). Взятые вместе, эти результаты показывают, что REcount точно сообщает о содержании шаблона, в то время как измерения на основе ПЦР вносят возрастающую ошибку с увеличением количества циклов.

    Дополнительный рисунок 3.Проверка и данные капельного цифрового ПЦР-анализа.

    A) Схема, изображающая два анализа ddPCR, которые были разработаны для каждой конструкции в пуле плазмид. B) Данные кПЦР, показывающие специфичность каждого анализа для целевой конструкции, оцененную путем амплификации каждой отдельной плазмиды, пула четных плазмид или отрицательного контроля с каждой парой праймеров. C) Корреляция между данными ddPCR и количественным определением REcount для исходного четного пула плазмид. D) подсчет ddPCR для повторно объединенного пула плазмид.Столбцы представляют собой среднее значение трех повторностей прямого и обратного анализов ddPCR, где данные могут быть получены для обоих анализов, или только для прямого или обратного анализа в случае, если один анализ не удался. * Для плазмиды 16 ни прямой, ни обратный анализы не дали результатов, и поэтому информация о ddPCR недоступна для этой конструкции. E) Корреляция между данными ddPCR и количественной оценкой REcount для повторно объединенного четного пула плазмид. F-I) Корреляция между данными ddPCR и количественной оценкой на основе BC PCR повторно объединенного четного пула плазмиды, амплифицированного для F) 10, G) 20, H) 30, I) 40 циклов ПЦР.

    Дополнительная фигура 4. Оценка измерений REcount пула плазмид в шахматном порядке.

    A) Среднеквадратичное отклонение корня от ожидаемых значений при измерении пула плазмид в шахматном порядке с использованием REcount и различных циклов ПЦР-амплификации конструкции штрих-кода. B) Сравнение измерений REcount и PCR пула плазмид в шахматном порядке. C) Среднее измеренное представление объединенных конструкций на разных уровнях относительно ожидаемых значений при измерении с использованием REcount или различных циклов ПЦР.D) Корреляция данных ddPCR и измерений REcount разнесенного пула плазмид. E-H) Корреляция между данными ddPCR и количественной оценкой на основе BC PCR разнесенного пула плазмид, амплифицированного для E) 10, E) 20, G) 30, H) 40 циклов ПЦР. Планки погрешностей +/- s.e.m.

    Одним из недостатков метода REcount является то, что индексы, которые определяют идентичность образца при мультиплексном секвенировании, которые обычно гибко добавляются с помощью ПЦР, жестко запрограммированы в конструкциях. Чтобы преодолеть это ограничение, мы проверили, можно ли использовать ортогональные рестрикционные ферменты для мультиплексирования измерений REcount.Первоначально мы выбрали M / y I в качестве фланкирующего фермента, поскольку он может точно высвобождать желаемую конструкцию Illumina с фланкированным адаптером. Мы проверили, могут ли другие рестрикционные ферменты, которые не высвобождают чисто промывные концы адаптеров Illumina, также использоваться для измерений REcount. Первоначально мы протестировали Bsm I, Bts α I и Bsr DI, каждый из которых оставляет 2 н. 3 ’выступа. Мы сконструировали пул из 12 плазмид, состоящий из трех наборов конструкций со штрих-кодом, фланкированных либо M / y, I, либо Bsm I, Bts, α I или Bsr DI (рис. 2A).Кроме того, все 12 этих конструкций содержали пару сайтов Sbf, I, расположенных таким образом, что расщепление Sbf I высвобождает все 12 кассет Illumina, фланкированных адаптером, с дополнительными выступами на 30-36 п.н. перед адаптером проточной кюветы p5 и между 40-50 п.н. ниже p? адаптер проточной ячейки. Мы расщепили этот пул плазмид каждым из 5 ферментов индивидуально, секвенировали расщепления и сопоставили считывания с эталонным файлом, содержащим все 12 ожидаемых штрих-кодов.Для M / y I, Bsm I, Bts α I и Bsr DI ожидаемые штрих-коды были обнаружены для каждого соответствующего фермента (рис. 2B-E, G-J). Все 12 штрих-кодов были обнаружены при переваривании пула с помощью Sbf I, что указывает на то, что кластеризация и секвенирование могут происходить даже при наличии больших выступов (30-50 п.н.) (Рисунок F, K). Нам не удалось определить, влияет ли длина выступа на эффективность кластеризации, поскольку каждый из этих образцов был секвенирован в части дорожки MiSeq вместе с другими библиотеками.Мы наблюдали различное количество обнаруженных нецелевых штрих-кодов в этих ортогональных дайджестах: от <0,2% в расщеплении Bsm I до приблизительно 6% в переваривании Bts α I (рис. 2B-E, G-J). Вероятно, это можно улучшить, добавив шаг выбора размера. Тем не менее, тот факт, что несколько рестрикционных ферментов можно использовать для высвобождения конструкций REcount, позволяет использовать потенциальные стратегии мультиплексирования, включающие ортогональное переваривание отдельных субпопуляций молекул или конкатамеризованных массивов штрих-кода.

    Рис. 2. Мультиплексирование измерений REcount с использованием ортогональных рестрикционных ферментов.

    A) Плазмиды, содержащие конструкции REcount, фланкированные сайтами разрезания ортогональных рестрикционных ферментов. B-F) Общее количество картированных считываний, идентифицированных для каждого типа конструкции, когда пул плазмид переваривается указанным ферментом. G-K) Картированные считывания, идентифицированные для каждой конструкции, когда пул плазмид переваривается указанным ферментом.

    Хотя известно, что размер молекулы влияет на кластеризацию и эффективность секвенирования на секвенаторах Illumina (Illumina 2014), степень этой систематической ошибки и степень ее различий между различными приборами Illumina не были подробно охарактеризованы.Таким образом, мы использовали REcount для характеристики профилей смещения размера секвенсоров Illumina MiSeq, HiSeq 2500, HiSeq 4000, NextSeq и NovaSeq. Мы синтезировали 30 конструкций, каждая из которых содержала M / y I-фланкированный штрих-код согласованной длины (164 п.н.) и вставку переменной длины, содержащую штрих-код от 22 п.о. до 1372 п.н. молекул от 150 до 1500 п.н. (рис. 3А). Чтобы свести к минимуму артефакты, зависящие от последовательности, вставки переменной длины были выбраны так, чтобы они содержали от 42% до 58% GC, и состояли из 10 конструкций каждая (охватывающих весь диапазон размеров от 150 до 1500 пар оснований), полученных из трех различных молекулы; Escherichia coli ( E.coli ) ген 16S рРНК (16S), Drosophila melanogaster ( D. melanogaster ) ген альфа-Tubulin84B (тубулин) и D. melanogaster ген глицеральдегид-3-фосфатдегидрогеназы 1 916 (Дополнительный рисунок S5).

    Дополнительный рисунок 5. Состав стандартного пула размера Illumina и данные.

    A) Состав стандартных конструкций размера Illumina, которые состоят из трех различных основных молекул (16S рРНК, GAPDH и тубулин) длиной от 150 до 1500 пар оснований.B) Между дорожками и между проточными кюветами различия в профилях смещения размера для HiSeq2500 Rapid Run (встроенная кластеризация) и HiSeq2500 High Output (кластеризация cBot). C) Зависящие от шаблона отклонения в размере, наблюдаемые на HiSeq2500 в режиме Rapid Run. D) Средние показатели качества, специфичные для платформы и конструкции, для стандартных конструктов размера Illumina для первых 50 п.н. чтения 1.

    Рис. 3. Стандарты размера Illumina позволяют измерять погрешности размера, характерные для секвенатора.

    A) Дизайн стандартных конструкций размера Illumina на основе REcount.Каждая стандартная конструкция содержит штрих-код нормализации, а также штрих-код, связанный со стандартом переменного размера, который может быть выделен путем расщепления M / y I и непосредственно секвенирован. Б) Исходные данные о численности для всех 30 стандартов размера и штрих-кодов нормализации из прогона MiSeq. C) Вариабельность нескольких запусков MiSeq от цикла к запуску (n = 6 проточных кювет). D) Профили смещения размера MiSeq (n = 6 проточных кювет), HiSeq 2500 Rapid (n = 1 проточная кювета, 2 дорожки), HiSeq 2500 High Output (HO, n = 2 проточные кюветы, 10 дорожек), HiSeq 4000 ( n = 3 проточные кюветы, 6 дорожек), секвенсоры NextSeq (n = 4 проточные кюветы) и NovaSeq (n = 1 проточная кювета, 1 дорожка).E) Профили смещения размера одной и той же библиотеки либо сгруппированы в MiSeq сразу после денатурации, либо сгруппированы после замораживания и оттаивания денатурированной библиотеки. Планки погрешностей +/- s.e.m.

    Эти стандартные конструкции размера Illumina были объединены в эквимолярном соотношении, основанном на измерениях флуорометрической концентрации ДНК, расщеплены с помощью M / y I и секвенированы на различных секвенаторах ДНК Illumina без промежуточного этапа очистки, чтобы гарантировать отсутствие материала. потерял. Типичные данные одного запуска MiSeq показаны на рисунке 3B.Поскольку каждый штрих-код нормализации присутствует в эквимолярном соотношении к соответствующему стандарту размера (поскольку они находятся на одной плазмиде), это позволяет учесть любые неточности в объединении плазмид. В рамках платформы для секвенирования смещение размера кластера проявляется в вариациях от цикла к запуску (рис. 3C). Все пять секвенсоров, которые мы тестировали, показали предпочтительную кластеризацию более мелких фрагментов, что согласуется с предыдущими анекдотическими наблюдениями (рис. 3D). Однако величина этого эффекта и формы кривых смещения размера существенно различаются между MiSeq, HiSeq 2500, HiSeq 4000, NextSeq и NovaSeq (рис. 3D).Также были замечены различия между HiSeq 2500 в режимах Rapid Run (встроенная кластеризация) и High Output (кластеризация cBot) (Рисунок 3D). Кроме того, мы наблюдали влияние длины молекулы на показатель качества секвенирования с общей тенденцией к более длинным молекулам, имеющим более низкие показатели качества (дополнительный рисунок S5). Величина влияния длины молекулы на качество последовательности варьировалась между различными инструментами.

    Процесс денатурации также может повлиять на размерную погрешность, наблюдаемую на приборах Illumina.Денатурированные библиотеки иногда сохраняются для повторного секвенирования в случае сбоя запуска (хотя передовой опыт Illumina рекомендует готовить недавно денатурированные библиотеки). Чтобы проверить, работают ли свеже денатурированные библиотеки иначе, чем замороженные денатурированные библиотеки, мы секвенировали недавно денатурированную библиотеку на MiSeq, а ту же денатурированную библиотеку через день, после цикла замораживания-оттаивания, на втором MiSeq. Цикл замораживания-оттаивания оказал существенное влияние на профиль отклонения размера этой библиотеки; в частности, наблюдалось резкое снижение доли молекул в 150 п.н., что привело к соответствующему сдвигу кривой вверх (рис. 3E).Вероятно, что этот сдвиг отражает дифференциальный повторный отжиг фрагментов размером 150 п.н. (которые находятся в молярном избытке из-за присутствия большого количества нормализационных штрих-кодов аналогичного размера) или других небольших библиотечных молекул в пуле секвенирования. Это наблюдение предполагает, что некоторая разница в смещении размера кластеризации, наблюдаемая между различными платформами, может быть связана с различиями в условиях денатурации, времени между загрузкой библиотеки и кластеризацией, а также тем, происходит ли процесс кластеризации в охлаждаемом отсеке (например, как на MiSeq) или нет (например, HiSeq2500 и NextSeq).В соответствии с этой идеей разница между проточными кюветами HiSeq2500 и HiSeq 4000 намного больше, чем разница между дорожками одной и той же проточной кюветы (дополнительный рисунок S5, дополнительный рисунок S6).

    Дополнительный рисунок 6. Влияние контекста на кластеризацию стандартов размера.

    A) Различия в размерах стандартных измерений для трех прогонов HiSeq 4000 (3 разные проточные кюветы). B) Профиль размера фрагмента библиотеки, выполняемый вместе со стандартами размера, в первом прогоне HiSeq 4000.C) Профиль размера фрагмента библиотеки, выполняемый вместе со стандартами размера в прогоне 2 HiSeq 4000. D) Профиль размера фрагмента библиотеки, выполняемый вместе со стандартами размера в прогоне 3 HiSeq 4000. E) Различия в стандарте размера измерения для первого цикла HiSeq 4000 и первого цикла NextSeq. F) Профиль размера фрагмента библиотеки выполняется вместе со стандартами размера в первом прогоне NextSeq.

    Также вероятно, что часть вариабельности между проточными ячейками происходит из-за различий в распределении размеров библиотек, секвенируемых вместе с синтетическими стандартами размера, поскольку конкуренция за кластеризацию будет происходить между всеми молекулами в полосе секвенирования.Мы наблюдали сдвиг кривой, соответствующий уменьшенному представлению стандартов большего размера, когда они были секвенированы вместе с библиотекой, содержащей значительное количество материала, размер которого составлял менее 300 п.о., на HiSeq 4000 (дополнительный рисунок 6). Хотя стандарты размера были секвенированы вместе с разными библиотеками на разных инструментах, этой контекстно-зависимой кластеризации недостаточно, чтобы объяснить большие различия, которые мы видим между разными инструментами.Например, библиотеки с одинаковыми средними размерами и распределениями дали совершенно разные измерения смещения размера на NextSeq по сравнению с HiSeq 4000 (дополнительный рисунок 6).

    Удивительно, но мы также обнаружили случай смещения размера, зависящего от конструкции, особенно на платформе HiSeq 2500 в режиме Rapid Run (дополнительный рисунок S5). В отличие от MiSeq, HiSeq 2500 High Output, HiSeq4000, NextSeq и NovaSeq, где не наблюдались систематические смещения, специфичные для конструкции, кривые смещения размера для конструкций 16S, GAPDH и альфа-тубулина разделялись по мере увеличения размера, при этом 16S показывает гораздо меньше падения при увеличении размера молекулы.Одним из возможных объяснений этого различия является то, что ген 16S рРНК имеет существенную вторичную структуру (Woese et al. 1980), которая может служить для сокращения эффективной длины молекулы во время процесса кластеризации. Это явление может быть связано с различиями в процессе кластеризации или температурой на этой платформе, что может быть менее эффективным при диссоциации вторичной структуры гена 16S рРНК (https://support.illumina.com/bulletins/2016/10/considerations -when-миграции-nonillumina-библиотеки-между платформами секвенирования.html). HiSeq и MiSeq также имеют разные рекомендуемые концентрации NaOH для денатурирующих библиотек. Возможно, что длинные молекулы, особенно с высокостабильной вторичной структурой, не полностью денатурируются в денатурирующих условиях HiSeq.


    В итоге мы описываем REcount, новую стратегию для получения высокоточных и точных без ПЦР измерений созданных генетических конструкций на основе NGS. Подобные конструкции могут быть включены в библиотеки shRNA, CRISPR и транспозонов для улучшения количественной оценки этих молекул в объединенных генетических скринингах.В настоящее время такие измерения подвержены систематической ошибке, вносимой ПЦР, как мы наблюдали для ампликонов BC и V4 (рисунок 1, дополнительный рисунок S4). Такие смещения амплификации, специфичные для последовательности, часто смягчаются включением входных контролей, которые, как считается, точно моделируют смещения амплификации. Однако на ошибки амплификации может влиять концентрация матрицы и контекст других молекул в реакции амплификации (Gohl et al., 2016), и они могут ограничивать чувствительность этих анализов за счет сжатия динамического диапазона (дополнительный рисунок S4).Одной из проблем использования штрих-кодов для количественной оценки без ПЦР в этих контекстах является большое количество геномной ДНК по сравнению с конструкцией штрих-кода без ПЦР. Однако мы показали, что пулы транспозонов могут быть количественно определены из выделенной геномной ДНК E. coli с использованием этого подхода (данные не показаны). Мы также продемонстрировали, что мультиплексирование измерений REcount возможно с использованием ортогональных рестрикционных ферментов (рис. 2).

    Мы использовали REcount для измерения смещения размера на нескольких различных секвенсорах Illumina.Мы обнаружили, что погрешность в размере может варьироваться в зависимости от серии экспериментов и инструментов, и что процедура денатурации может влиять на погрешность в размере (рис. 3). Из-за конкурентной кластеризации молекул разного размера вполне вероятно, что часть вариабельности между сериями и дорожками связана с различиями в распределении размеров библиотек, секвенируемых вместе со стандартами синтетического размера. Таким образом, форма кривой смещения размера, вероятно, чувствительна как к распределению размеров библиотек, секвенируемых вместе со стандартами размера, так и к доле полосы, посвященной стандартам размера.

    Хотя не ожидается, что такие смещения размеров повлияют на библиотеки, подвергнутые произвольному срезанию, эти результаты показывают, что следует проявлять осторожность при интерпретации количественных измерений или сравнении данных на разных платформах. Это особенно верно в случаях, когда распределение размера библиотеки неслучайно, например, в некоторых методах профилирования хроматина (например, ATAC-Seq (Buenrostro et al. 2013), FAIRE-Seq / MAINE-Seq (Ponts et al. 2010)), подходы, использующие рестрикционное расщепление для фрагментации ДНК (например,грамм. RAD-Seq (Andrews et al., 2016)), ампликоны, которые различаются по длине (например, ITS-секвенирование грибов (Taylor et al., 2016)), или такие методы, как TAIL-Seq (Chang et al. 2014), которые явно стремятся измерить длина молекулы. Конструкции, подобные описанным здесь, можно регулярно добавлять в прогоны секвенирования Illumina для отслеживания систематической ошибки размера, аналогично использованию PhiX для составления отчетов о частоте ошибок секвенирования и других метриках вызова базы.


    Синтез и клонирование плазмид REcount

    Четные и шахматные пулы плазмид

    Плазмиды, содержащие четные и ступенчатые пулы, были разработаны для включения части гена 16S рРНК одного из двадцати различных видов бактерий, смоделированных на Human Microbiome Project имитирует микробные сообщества (HM-276D и HM-277D, (2012a, 2012b), с тегом последовательности 3 п.н. «TCT», добавленным в аналогичное положение в каждой конструкции.Эти конструкции также содержали сайт I-SceI, позволяющий линеаризовать плазмиды, и конструкцию REcount, состоящую из уникального штрих-кода ДНК длиной 20 п.н., фланкированного адаптерами Illumina, и сайтов рестрикции M / y I, расположенных таким образом, чтобы точно высвободить конструкцию штрих-кода, содержащую адаптер Illumina (Supplemental_File_1). Эти конструкции были синтезированы в виде плиток ДНК с помощью SGI-DNA и собраны в конструкции полной длины с использованием BioXP 3200 (SGI-DNA). Собранные фрагменты ДНК имели А-хвост с использованием модуля А-хвоста из NEB, клонированного в pCR2.1 с использованием набора для клонирования TOPO TA (Thermo Scientific) и трансформировали в химически компетентный OneShot TOP10 E. co / i (Thermo Scientific). Было отобрано несколько колоний, ДНК была выделена с использованием набора Qiagen MiniPrep, и подтвержденная последовательность клонов была идентифицирована секвенированием по Сэнгеру со следующими праймерами:



    Двадцать плазмид с подтвержденной последовательностью анализ дцДНК Quant-iT PicoGreen (Thermo Fisher Scientific), нормализованный до 50 нг / мкл и объединенный в равном объеме для создания исходного равномерного пула.Повторно объединенный четный пул и шахматный пул были получены путем регулировки объема пула на основе исходных данных без ПЦР секвенирования исходного четного пула.

    Ортогональные ферментные мультиплексирующие плазмиды

    Были синтезированы четыре синтетических генных фрагмента (IDT) в остове плазмиды pIDTSmart-Amp, состоящем из адаптера Illumina, содержащего конструкцию с внутренним сайтом Pac I и Pme I, фланкированного парой либо M / y I, Bsm I, Bts α I, либо Bsr DI сайтов.Полные конструкции также были фланкированы парой сайтов Sbf I (дополнительный файл 2). Для создания коллекции конструкций, содержащих штрих-код, шаблоны плазмид были амплифицированы с использованием следующих специфичных для шаблона праймеров, и для повторного создания кольцевой плазмиды была использована реакция клонирования Golden Gate:










    Вкратце, реакции ПЦР проводили с использованием следующего рецепта: 1 мкл плазмидной ДНК (20 нг / мкл), 2.5 мкл праймера 1 (10 мкМ), 2,5 мкл праймера 2 (10 мкМ), 19 мкл воды и 25 мкл 2x мастер-смеси Q5 (NEB). ПЦР-амплификацию проводили с использованием следующих условий циклов: 98 ° ° C в течение 30 секунд, затем 30 циклов 98 ° ° C в течение 20 секунд, 60 ° ° C в течение 15 секунд, 72 ° ° C в течение 1,5 секунд. минут, затем 72 ° ° C в течение 5 минут. Реакции Golden Gate (Engler et al. 2008, 2009) были созданы с использованием следующего рецепта:

    1 мкл продукта ПЦР Barcoding, указанного выше, 2 мкл буфера NEB Cutsmart, 2 мкл 10 мМ АТФ (NEB), 12.5 мкл воды, свободной от нуклеаз, 0,5 мкл Bsa I-HF, 1 мкл ДНК-лигазы Т4 (NEB 400000 Ед / мл), 1 мкл Pac I. Реакции Golden Gate циклически выполнялись в следующих условиях: 10 циклов по 37 ° C в течение 5 минут, 21 ° C в течение 5 минут, затем 1 цикл 37 ° C в течение 10 минут, затем 1 цикл 80 ° C в течение 20 минут. Реакциями Golden Gate трансформировали химически компетентные клетки E. coli 5alpha (NEB). Отбирали колонии и выделяли ДНК с использованием набора Qiagen Mini-Prep.Конструкции с уникальным штрих-кодом были идентифицированы секвенированием по Сэнгеру с использованием следующих праймеров:


    UMGC_350-pIDT-Smart-Rev: ACCGATCATACGTATAATGCCGTAA Проверено количественно Анализ дцДНК PicoGreen (Thermo Fisher Scientific), нормализованный до 50 нг / мкл и объединенный в равном объеме для создания пула теста мультиплексирования ортогональных ферментов. Последующий анализ NGS показал, что некоторые из этих клонов были смешанными изолятами, поскольку в наборах данных NGS присутствовали другие штрих-коды, которые не были обнаружены секвенированием по Сэнгеру.Анализ основан только на штрих-кодах, проверенных Сэнгером.

    Стандартные плазмиды размера Illumina

    Стандартные размеры Illumina были сконструированы с использованием трех различных молекул-шаблонов в качестве основы для фрагмента переменной длины; ген 16S рРНК (16S) из E. coli , ген альфа-Tubulin84B (тубулин) из D. melanogaster и ген глицеральдегид-3-фосфатдегидрогеназы (GAPDH) из D. melanogaster (дополнительный рисунок S5).Любые встречающиеся в природе сайты M / y I в этих фрагментах были модифицированы для удаления этого сайта рестрикции. Стандарты переменной длины представляют собой вложенные фрагменты этих трех генов с точками разрыва, выбранными для создания молекул определенной длины, с содержанием GC от 40 до 60% (Рисунок 3, Дополнительный Рисунок S5). Чтобы свести к минимуму повторяющиеся последовательности, были использованы разные адаптеры для стандартов нормализации и переменного размера (Nextera и TruSeq, соответственно), а стандарты нормализации и размера были синтезированы в конструкциях в противоположных ориентациях.Конструкции как адаптера Illumina, фланкированного вариабельной, так и нормализационной штрих-кода были фланкированы сайтами рестрикции M / y I. Стандартные конструкции размера Illumina были синтезированы GenScript в векторе клонирования pUC57 (дополнительный файл 3). Приблизительно 4 мкг каждой лиофилизированной плазмиды ресуспендировали в 40 мкл EB (Qiagen). Плазмиды были количественно определены с использованием анализа дцДНК Quant-iT PicoGreen (Thermo Fisher Scientific) и нормализованы до 10 нМ для учета переменных размеров плазмид, затем объединены в эквимолярном соотношении.

    Проверка количественной ПЦР анализов ддПЦР

    Набор праймеров, позволяющих амплификацию между конструктивно-специфическим штрих-кодом и адаптером проточной кюветы Illumina, либо в прямой ориентации (анализ 1, где специфичный для конструкции праймер был соединен с праймером p7) или обратная ориентация (анализ 2, где специфичный для конструкции праймер был спарен с праймером p5) были сконструированы и синтезированы (Integrated DNA Technologies, Supplemental File 4). Чтобы проверить эти анализы, мы выполнили qPCR-амплификацию каждой отдельной плазмиды, пула четных плазмид и отрицательного контроля (вода) с каждым из 40 наборов праймеров, а также положительного контроля p5 / p7 (который, как ожидается, усилить все конструкции).Реакции ПЦР проводили следующим образом: 3 мкл матричной ДНК (0,05 нг / мкл), 1,06 мкл воды, свободной от нуклеаз, 0,6 мкл 10-кратного буфера для ПЦР Qiagen, 0,24 мкл MgCl 2 (25 мМ), 0,3 мкл ДМСО, 0,048 мкл. dNTP (25 мМ), 0,12 мкл ROX (25 мкМ), 0,003 мкл SYBR (1000x), 0,03 мкл Qiagen Taq (5 ед / мкл), 0,3 мкл праймера 1 (10 мкМ) и 0,3 мкл праймера 2 (10 мкМ) . Реакции были усилены на ABI 7900 в следующих условиях цикла: 95 ° C в течение 5 минут, затем 35 циклов: 94 ° C в течение 30 секунд, 55 ° C в течение 30 секунд и 72 ° C в течение 30 секунд с последующей инкубацией при 72 ° C в течение 1 минуты.Для каждого набора праймеров значения Ct нормализовали до среднего значения Ct для этого набора праймеров для всех плазмид и наносили на график в виде тепловой карты (дополнительная фигура S5).


    Повторно объединенную четную смесь плазмид количественно оценили с помощью анализа дцДНК Quant-iT PicoGreen (Thermo Fisher Scientific), разбавив до 1 нг / мкл, а затем разбавив 1: 10 000, чтобы довести пул до нужной концентрации для цифровая количественная оценка. Были приготовлены следующие реакции ddPCR: 5 мкл матричной ДНК, 0,44 мкл праймера 1 (10 мкМ), 0.44 мкл праймера 2 (10 мкМ), 5,12 мкл воды и 11 мкл реакционной смеси EvaGreen (BIO-RAD). Кроме того, 2 мкл / -See / добавляли к основной смеси ddPCR для линеаризации матриц плазмидной ДНК, в результате чего получали от 0,02 до 0,075 мкл / -See / на реакцию. Капли эмульсии были созданы с использованием генератора капель QX200 (BIO-RAD) в соответствии с инструкциями производителя, перенесены в 96-луночный планшет для ПЦР и подвергнуты циклической обработке в следующих условиях: 95 ° C в течение 10 минут, затем 40 циклов: 95 ° C в течение 30 секунд. и 55ºC в течение 1 минуты, с последующим заключительным этапом расширения при 72ºC в течение 5 минут и выдержкой 12ºC.

    Капель подсчитывали с помощью устройства для чтения капель QX200 (BIO-RAD). Повторно объединенную даже смесь плазмид запускали в трех повторностях как для прямого, так и для обратного анализов. Единичные повторы как исходного четного пула, так и шахматного пула были запущены для обоих анализов. Для шахматного пула степень разведения пула плазмиды 1 нг / мкл варьировалась таким образом, чтобы предполагалось, что численность матрицы плазмиды, на которую нацелен набор праймеров, будет при правильной концентрации для цифрового количественного определения.Данные анализировали с помощью программного обеспечения QuantaSoft Analysis Pro (BIO-RAD). Повторные измерения усредняли (при наличии) для обоих анализов ddPCR, чтобы получить измерение среднего количества ddPCR для каждой конструкции. Данные анализа не включались в случаях, когда не было четкого разделения между положительными и отрицательными каплями.

    Подготовка библиотеки для секвенирования

    Равномерный и ступенчатый пул Измерения REcount

    Следующие расщепления M / y I были настроены для количественного анализа без ПЦР: 200-500 нг четной или ступенчатой ​​ДНК пула, 2 мкл Cutsmart-буфера (NEB) , 1 мкл MlyI (NEB), и объем доводили до 20 мкл водой, свободной от нуклеаз.Дайджесты инкубировали при 37 ° C в течение 1 часа, а затем 20 минут при 65 ° C. В каждый гидролизат добавляли 30 мкл воды (чтобы довести объем до 50 мкл). Добавляли 30 мкл (0,6x) шариков AmpureXP (Beckman Coulter) и после 5-минутной инкубации шарики собирали на магните и супернатант переносили в новую пробирку (отброшенные шарики). Добавляли 80 мкл (1x) гранул AmpureXP, промывали 2 раза в течение 30 секунд, используя свежий 80% этанол, и гранулы сушили на воздухе в течение 10 минут с последующей элюцией в 20 мкл EB (Qiagen).Количественную оценку библиотек проводили с использованием анализа дцДНК Quant-iT PicoGreen (Thermo Fisher Scientific), размеры фрагментов оценивали с помощью анализа высокой чувствительности Agilent Bioanalyzer, и библиотеки нормализовали до 2 нМ для секвенирования.

    Четные и ступенчатые измерения пула на основе ПЦР
    Приготовление библиотеки конструктов штрих-кода (BC)

    Для амплификации конструкций BC были установлены следующие реакции ПЦР: 1 мкл ДНК (1 нг / мкл), 5 мкл 10-кратного ПЦР-буфера Qiagen , 2 мкл MgCl 2 (25 мМ), 2.5 мкл ДМСО, 0,4 мкл dNTP (25 мМ), 0,25 мкл Qiagen Taq (5 ед / мкл), 2,5 мкл праймера 1 (10 мкМ), 2,5 мкл праймера 2 (10 мкМ) и 33,85 мкл воды, свободной от нуклеаз.

    Для амплификации конструкций BC были использованы следующие праймеры:

    Образцы амплифицировали в следующих условиях цикла: 95 ° C в течение 5 минут, затем 10, 20, 30 или 40 циклов при 94 ° C в течение 30 секунд, 55 ° C в течение 30 секунд. , и 72ºC в течение 30 секунд с последующей инкубацией при 72ºC в течение 10 минут. Количественную оценку библиотек проводили с использованием анализа дцДНК Quant-iT PicoGreen (Thermo Fisher Scientific), размеры фрагментов оценивали с помощью анализа высокой чувствительности Agilent Bioanalyzer, и библиотеки нормализовали до 2 нМ для секвенирования.

    Подготовка библиотеки фрагментов V4

    Следующие реакции ПЦР были проведены в трех экземплярах для амплификации конструкций V4: 2 мкл ДНК (0,1 нг / мкл), 0,5 мкл праймера 1 (10 мкМ), 0,5 мкл праймера 2 (10 мкМ) , 2 мкл воды, свободной от нуклеаз, и 5 мкл мастер-микса 2x Q5. Были использованы следующие праймеры:





    реакции амплифицировали с использованием следующих езды на велосипеде условия: 98 ° С в течение 30 секунд, после чего 10, 20, 30, или 40 циклы 98 ° ° C в течение 20 секунд, 55 ° ° C в течение 15 секунд, 72 ° ° C в течение 1 минуты, затем 72 ° ° C в течение 5 минут.

    После начальной амплификации реакции ПЦР разводили 1:60 в воде, свободной от нуклеаз, и использовали в качестве матриц в следующих реакциях индексации: 3 мкл ПЦР 1 (разведение 1:60), 1 мкл индексирующего праймера 1 (5 мкМ), 1 мкл индексирующего праймера 2 (5 мкМ) и 5 ​​мкл мастер-микса 2x Q5. Были использованы следующие индексации праймеров (Х указывает позиции индексов 8 п.н.):

    Форвард индексирование праймер:


    Обратный индексирование праймер:


    реакции амплифицировали с использованием следующих езды на велосипеде условия: 98 ° C в течение 30 секунд, затем 10 циклов 98 ° C в течение 20 секунд, 55 ° C в течение 15 секунд, 72 ° C в течение 1 минуты, затем 72 ° C в течение 5 минут.Затем реакции ПЦР с полным индексированием очищали и нормализовали с использованием планшета для нормализации SequalPrep (Thermo Fisher Scientific) с последующим элюированием в 20 мкл буфера для элюции. Равный объем нормализованных библиотек объединяли и концентрировали с использованием 1х шариков AmpureXP (Beckman Coulter). Объединенные библиотеки количественно оценивали с помощью анализа широкого диапазона дцДНК Qubit (Thermo Fisher Scientific), размеры фрагментов оценивали с помощью анализа высокой чувствительности Agilent Bioanalyzer, и библиотеки нормализовали до 2 нМ для секвенирования.

    Тесты мультиплексирования ортогональных ферментов

    Пул ортогональных ферментов из двенадцати плазмид был разрезан одним из 5 различных ферментов (в отдельных реакциях) с использованием следующего рецепта и условий инкубации для конкретных ферментов: 20 мкл ДНК (1 мкг), 4 мкл NEB буфер (CutSmart или NEB 2.1, в зависимости от фермента), 2 мкл фермента (либо M / y I [37 ° C в течение 1 часа, затем 65 ° C в течение 20 минут], Bsm I [ 65 ° C в течение 1 часа, затем 80 ° C в течение 20 минут], Bts α I [55 ° C в течение 1 часа] или Bsr DI [65 ° C в течение 1 часа, затем 80 ° ° C в течение 20 минут] или Sbf I [37 ° ° C в течение 1 часа, затем 80 ° ° C в течение 20 минут]) и 14 мкл воды.10 мкл (0,5x) шариков AmpureXP (Beckman Coulter) добавляли к 20 мкл расщепленной ДНК и после пятиминутной инкубации шарики собирали на магните и супернатант переносили в новую пробирку (отброшенные шарики). Добавляли 20 мкл шариков AmpureXP, и шарики промывали 2 раза в течение 30 секунд, используя свежий 80% этанол, затем сушили на воздухе в течение 10 минут перед элюированием в 20 мкл EB (Qiagen). Количественную оценку библиотек проводили с использованием анализа дцДНК Quant-iT PicoGreen (Thermo Fisher Scientific), размеры фрагментов оценивали с помощью анализа высокой чувствительности Agilent Bioanalyzer, и библиотеки нормализовали до 2 нМ для секвенирования.

    Стандарты размера Illumina

    Был подготовлен следующий гидролизат стандартного пула размера Illumina: 175 мкл ДНК (10 нМ), 20 мкл буфера CutSmart (NEB), 5 мкл M / y I (NEB). Реакционную смесь инкубировали при 37 ° ° C в течение 1 часа, затем при 65 ° ° C в течение 20 минут. Библиотеку количественно оценивали с помощью анализа дцДНК Quant-iT PicoGreen (Thermo Fisher Scientific), размеры фрагментов оценивали с помощью анализа высокой чувствительности Agilent Bioanalyzer, и библиотеки нормализовали до 2 нМ для секвенирования.



    ДНК были денатурированы с помощью NaOH и подготовлены для секвенирования в соответствии с протоколами, описанными в Illumina MiSeq, NextSeq, HiSeq 2500, HiSeq 4000 и NovaSeq. Библиотеки, как правило, секвенировали вместе с другими образцами на части полосы секвенирования.

    Анализ данных

    Данные REcount были проанализированы с использованием пользовательских сценариев R и Python и BioPython (Cock et al. 2009). Первые 20 пар оснований считываний секвенирования были сопоставлены со справочным файлом штрих-кода (Дополнительные файлы 5-8), при этом допускается не более 2 несовпадений.Обобщенный скрипт для подсчета штрих-кодов REcount, содержащихся в справочном файле, доступен на Github (https://github.com/darylgohl/REcount). Анализ данных ампликона V4 был выполнен с использованием описанного здесь конвейера сопоставления на основе ссылок: https://bitbucket.org/jgarbe/gopher-pipelines/wiki/metagenomics-pipeline.rst, с использованием справочного файла в дополнительном файле 9 для построения индекс bowtie2 (Langmead and Salzberg 2012). Для анализа показателей качества (дополнительный рисунок S5) данные для всех прогонов на данной платформе были объединены в один файл fastq, разделенный на отдельные файлы fastq для каждой отдельной конструкции на основе штрих-кодов последовательности 20 п.н. в каждой конструкции. .Затем считывания были обрезаны до 50 п.н. с помощью cutadapt (Martin 2011), чтобы все конструкции и прогоны секвенирования можно было сравнить стандартизированным способом. Средние оценки качества были рассчитаны для каждой конструкции, которая была представлена ​​как минимум 100 чтениями в наборе данных.

    Доступ к данным

    Файлы данных секвенирования доступны в архиве чтения последовательности NCBI (BioProject: PRJNA431017).

    Вклад авторов

    D.M.G. и K.B.B. задумал и спланировал эксперименты, проанализировал данные и написал рукопись.D.M.G., A.B., D.J., S.A., B.B. и S.M. провели эксперименты.

    Заявление о раскрытии информации

    Описанная здесь технология количественного определения количества штрих-кодов REcount без ПЦР включена в заявки на патенты США 62/332879, 62/630463 и PCT / US17 / 31271. D.M.G. является акционером и CSO CoreBiome, Inc. K.B.B. является акционером и операционным директором CoreBiome, Inc.


    Мы благодарим сотрудников Центра геномики Университета Миннесоты за советы, техническую поддержку и сбор данных, а также Винсента Дж.Coates Genomics Sequencing Laboratory в Калифорнийском университете в Беркли для генерации данных. Мы также благодарим Алессандро Мальи, Даниэля Шмидта, Игоря Либуреля, Стива Боудена, Бенджамина Оша, Джона Гарбе и Нагендру Палани за полезные обсуждения. Эта работа была поддержана грантом Фонда развития переводческих продуктов Университета Миннесоты в Мейо компании D.M.G. и K.B.B. (Национальный центр развития трансляционных наук при Национальном институте здравоохранения, номер премии UL1TR000114). Лаборатория геномного секвенирования Винсента Дж. Коутса в Калифорнийском университете в Беркли была поддержана грантом NIH S10 OD018174 на оборудование.

    Girl Life Wiki — Павловский список НПЦ

    Преподаватели и преподаватели


    Руслан Кузнецов — специальный редактор школы, консультант по вопросам карьеры и цеховой учитель.

    Илья Енотин — школьный учитель литературы, языка и классный руководитель.

    Царев Анатолий Евгеньевич — учитель математики в школе.

    Михаил Николаевич — тренер школьной волейбольной команды.

    Серафим Иванов — школьный учитель информатики и информатики.

    Виктор Павлович — учитель физкультуры в школе.

    Макар Васильев — учитель музыки, искусства и драмы в школе.

    Ролан Матвеев — дворник

    Девч. ​​

    Александра Волкова — новая директриса школы.

    Ева Соколова — учитель географии и истории в школе.

    Рэйвен Бракман — школьный учитель социальных наук и преподаватель английского языка. Она из Южной Африки.

    Арина Орлова — школьный учитель биологии и здоровья.Она самая юная учительница в школе.

    Ольга Александрова — школьная медсестра.




    Аркадий Федоров

    Дан Рыжов

    Лаврентий Романов

    Николай Волков

    0003 Попов







    Алена Зима

    Анушка Константинова

    Екатерина «Катюша» Максимов

    Лена Котова

    Лера Царев

    Полина Себаготуна



    Димка Носов

    Игорь Круглов

    Маркус Ларсон

    Мефодий Уткин


    Белла Артамонов

    Ирина Девятова

    Катя Мейнольд

    Лизавета Мейнольд


    004 Виктория Мейнольд



  • Добавить комментарий

    Ваш адрес email не будет опубликован.