Мышечный вектор: Мышечный вектор | Психологические тренинги и курсы он-лайн. Системно-векторная психология

Автор: | 13.05.1978

Содержание

Мышечный вектор | Психологические тренинги и курсы он-лайн. Системно-векторная психология

Без него существование современной цивилизации было бы невозможно. Привыкшие к устроенной жизни люди не задумываются, откуда берутся продукты в магазинах, кто работает на соседней ТЭЦ и благодаря чему работает канализация. Все это держится на плечах мышечной части человечества.

32 331253 20 Июня 2010 в 20:48

Автор публикации: Мария Грибова, специалист в области международного права и международных отношений

Характерные речевые обороты:

  • Сила есть — ума не надо.
  • Тяжело в учении — легко в бою.
  • Куда все, туда и я!

Общая характеристика

Численность В чистом виде — 38 %, всего — 95 %
Архетип Фундаментальная масса живого вещества
Видовая роль В мирное время — строитель
В военное время — воин-охотник
Цвет наибольшего комфорта Черный
Геометрия наибольшего комфорта Прямоугольник
Место в квартели Внутренняя часть квартели пространства, интроверт
Тип мышления Практическое, наглядно-действенное

 

Особенности психики

Мышечный вектор формирует собой внутреннюю часть квартели пространства.

Это — основа, фундамент всего живого.

Все свойства-желания мышечного вектора направлены на обеспечение четырех базовых потребностей человека: есть, пить, дышать, спать.

Мышечный вектор — самый многочисленный. Носителями мышечного вектора являются около 95 % людей. Однако только про 38 % из них мы говорим как про мышечных людей. Почему?

Дело в том, что в сочетании с другими нижними векторами (анальным, кожным, уретральным) мышечность лишь усиливает имеющиеся у них желания, полностью сливаясь с ними в свойствах. Так, про человека с анальностью и мышечностью мы скажем «мощный анальник», про человека с уретрой и мышечностью — «мощный уретральник» и так далее. Таким образом, мышечниками мы называем только тех людей, которые не имеют других нижних векторов.

Оставшиеся 5 % людей рождаются без мышечного вектора. Нужно понимать, что отсутствие мышечного вектора не означает отсутствие мышечной массы, так же как отсутствие, например, зрительного вектора не означает отсутствия глаз. Это означает, что у человека нет такой эрогенной зоны. Как человек без зрительного вектора не стремится любоваться прекрасным, переживать глубокие эмоциональные состояния, так человек без мышечного вектора не стремится к увеличению мышечной массы и не получает удовольствия от физического труда. Мышечный каркас у такого человека относительно слабый, причем это нельзя изменить никакими упражнениями.

Далее мы будем говорить о мышечных людях в чистом виде.

В первобытной стае мышечный человек выполнял роль воина на войне и строителя в пещере. Именно мышечная часть в первую очередь обеспечивала выживание, добывая пропитание на охоте, защищая стаю от внешней угрозы и завоевывая новые территории. Под предводительством уретрального вождя и командованием кожных командиров, не жалея своих жизней, они шли на охоту и войну и убивали. Позднее мышечные воины формировали основной состав армий. Они легко забирали жизнь других и так же легко отдавали свою. Отдать свою жизнь в бою — ценность мышечного человека.

Сегодня роль мышечников как военных уходит в прошлое. Все противостояние держав сводится к политике сдерживания. Отдельные локальные конфликты приобретают новые формы, и в современной армии важнее владеть всеми новинками вооружений, чем идти врукопашную. Роль мышечных рядовых бойцов все больше и больше теряет свое значение, их место переходит к специалистам, способным владеть ультрасовременной военной техникой. Поэтому основное поле деятельности для мышечников сегодня — это полезный физический труд, создающий основу для выживания всей стаи.

Нужно понимать, что без мышечного человека существование современной цивилизации было бы невозможно. Привыкшие к устроенной жизни современного города люди не задумываются, откуда берутся продукты в магазинах, кто работает на соседней ТЭЦ и благодаря кому в их квартирах работает канализация. Все это держится на плечах мышечной части человечества.

При этом самое большое и важное дело, которым сегодня может заняться мышечный человек, — это строительство. Особенно это необходимо современной России: в условиях разрушенной системы ЖКХ, острой нехватки жилья и при наличии огромных незаселенных территорий только мышечники способны на деле построить дома и города, отладить систему жилищно-коммунального хозяйства.

Два базовых состояния мышечного человека — это ярость и монотония. Ярость приводит его в состояние «война», когда он просто идет и убивает. Абсолютная монотония — в состояние «мир», когда час за часом, день за днем он строит дома, трудится в шахте, пашет землю…

Мышечные люди — очень миролюбивые, перевести их из состояния монотонии в состояние ярости трудно, но возможно. Этого не произойдет до тех пор, пока не посягнут на обеспечение их потребностей (есть, пить, дышать, спать). Так, не стоит отбирать у мышечного человека крышу над головой, выхватывать тарелку из рук, резко будить. Также людям с мышечным вектором нужно быть крайне аккуратными с употреблением спиртного: растормаживая кору головного мозга, алкоголь выпускает наружу мышечного воина-охотника — прирожденного убийцу.

Мышечники никогда не мыслят категорией «я». Все их мироощущение построено на «мы». Человек без мышечного вектора никогда не сможет присоединиться к этому «мы». Каким бы он ни был, он никогда не станет частью единого монолитного мышечного «мы», как говорится — своим в доску.

Весь мир у мышечного человека разделен по территориальному признаку на «мы — свои» и «мы — чужие»: наш двор — чужой двор, наша улица — чужая улица, наша стая — чужая стая.

Жизнь они строят так, чтобы максимально сохранять свою общность. При этом ориентируются на общепринятое — чтобы все было как у людей, «по-людски», «как у всех». Отделение от «мы» воспринимается мышечниками очень болезненно. Камеры-одиночки в тюрьмах — самое большое испытание для них.

Мышечники абсолютно ведомы. Они никогда не пойдут протестовать и крушить все вокруг сами по себе без побуждения со стороны. Они не имеют так называемого личного мнения, ведь для них первично единение в общее «мы», а не частность своего «я».

На вопрос: «Что вы думаете про эту ситуацию?» — мышечник ответит: «А что я? Как все, так и я». Мышечный человек поступает так, как его научили.

Кем станет мышечник, зависит от того, кто будет оказывать на него влияние. Если рядом окажется архетипичный кожный пьяница, то и мышечник начнет пить. Если рядом окажется анальный бригадир, то мышечник будет усердно работать. Здесь лежит решение проблемы спивающейся российской деревни.

Мышление мышечного человека наглядно-действенное. Как показали, так и будет делать. Не потому, что будет считать, что так правильно, так лучше, а потому, что ему сказали: «Делай так». При этом его ни в коем случае нельзя назвать глупым. У него особый ум. То, что сумеет мышечник, никогда не сумеет человек с другим набором векторов: никто так просто и ладно не забьет гвоздь, не распилит доску, не поставит забор. И обучать его нужно показывая все наглядно. Если стоит задача поддерживать костер, то нужно показать, как подкидывать хворост и откуда его брать, нужно все объяснить до мельчайших деталей.

Мышечники, как никто другой, привязаны к своей земле. При этом они абсолютно приспособлены к любому ландшафту. Это в городе они блуждают. А оказавшись, например, в лесу, мгновенно ориентируются на местности и знают, как здесь выжить: могут и дерево свалить, и шалаш построить, и птицу поймать.

Мышечный мужчина с подозрением относится к сексу, особенно когда он происходит, как ему кажется, «не по-людски», к примеру до брака. А мышечная женщина стремится поскорее выйти замуж: ее тело предназначено для рождения детей. Как только она достигает детородного возраста, у нее появляется сильнейшее желание не к сексу, но к рождению потомства.

Нужно понимать, насколько важно поддерживать численность населения. Каким бы великим ни был народ, если его численность слишком мала, на его место придут другие. Физическая мощь мышечных людей позволяет им порождать самое большое потомство: именно они рожают детей — больше, чем представители других векторов. Плохое состояние мышечности — плохая демография в стране, и наоборот.

До рождения пупочное отверстие — это канал, через который эрогенная зона мышечного человека — мышцы — соединяется с внешним миром. С рождением этот канал закрывается, прерывая обеспечение базовых потребностей (есть, пить, дышать, спать). Это ощущается мышечным ребенком как страдание: теперь все надо делать самому, самостоятельно.

Дальнейшая жизнь проходит в ощущении, что смерть — избавление. Мышечники не боятся смерти. Она воспринимается ими как возврат в первоначальное состояние, в чрево матери, где было так хорошо, где все их базовые потребности были обеспечены. Мышечные люди говорят: «Откуда пришел, туда и вернусь, вернусь в Матушку-землю».

По той же причине мышечные люди всегда оживляются при виде смерти. Именно они лучше всех смогут организовать похороны, поминки, стремясь «похоронить по-людски».

Мышечные дети очень покладистые, их не нужно особо воспитывать. Самое главное — не оставлять мышечного ребенка болтаться без дела и следить за тем, с кем он общается, иначе велика вероятность, что он попадет не в ту компанию.

Его необходимо приучать к тяжелому физическому труду, чтобы помогал в детстве родителям, чтобы научился наслаждаться именно трудом. Когда он копает, то испытывает мышечную радость. Нужно понимать, что именно через усилие мышц активируется мышление мышечного человека. Физический же труд направляет его в мирное русло — в строительство, работу на заводе, в шахте и т. п.

При этом категорически нельзя отдавать мышечных детей в спорт. Их физические данные не будут способствовать победам на соревнованиях, ведь у мышечника нет желания соревноваться, конкурировать, побеждать. Спорт даст чистому мышечнику состояние войны. Не приученный к физическому труду и отданный в спорт мышечник сможет впоследствии реализовать себя только в преступной деятельности.

Тщательно подбирайте людей, рядом с которыми будет находиться мышечный ребенок. В деревне он должен оказаться рядом с анальным бригадиром, который научит его физическому труду. В городе такой ребенок должен освоить ограничения крупного населенного пункта, поэтому здесь лучше всего отдать его в ПТУ. Там кожный учитель токарного дела научит мышечника не только ремеслу, но и дисциплинирует должным образом, научит ограничивать свои животные позывы.

Роль и значение мышечного вектора в жизни общества невозможно переоценить. Бедственное положение мышечности является причиной многих проблем современной России. О способах их решения и подробнее об особенностях разных векторов вы узнаете на онлайн-тренинге «Системно-векторная психология» Юрия Бурлана.

Корректор: Наталья Коновалова

Автор публикации: Мария Грибова, специалист в области международного права и международных отношений

Статья написана по материалам тренинга «Системно-векторная психология»

Мышечный вектор. Конспект свойств.: system_psiholog — LiveJournal

Численность
38 % в стае в чистом виде.
в смешении с другими векторами намного больше — примерно всего 3-5 % людей в современном мире без мышечности.

Архетип
фундаментальная масса живого вещества.

Видовая роль
воин, охотник.

Общая характеристика:
а) цвет наибольшего комфорта – черный
б) геометрия наибольшего комфорта – прямоугольник, кирпич;
в) место в квартели – внутренняя часть квартели ПРОСТРАНСТВО, интроверт;
г) тип мышления – наглядно-действенное.

Внешние признаки:
Рост высокий. Телосложение крупное.
Устойчивый (про такого говорят: «Крепко на земле стоит»). Сильный.
Тело с выраженным мышечным рельефом.
Широкая, толстая шея.

Особенности психики:
В основе всех психических процессов лежит монотония.
Идеально адаптирует ландшафт: внутреннее мышечное «Мы» — наиболее совершенное состояние психики для животного выживания на ладшафте, однако буквально врастая в ландшафт, испытывает колоссальное мучение при его смене, так как не способен к адатации нового ландшафта, не приспособлен к перемене своего
монотонного образа жизни.
Живут по принципу: как научат. Этот принцип работает в мышечности абсолютно во всем!
Психология массы, толпы.

Жизненные ценности:
Труд.
Сила.
Смерть в бою.

Личностные качества
Неприхотливость. Непритязательность.
Миролюбивостью.
Выносливость.
Низкая эмоциональная амплитуда.

Особенности речи:
Говорит мало, односложно.

Характеристики, поведенческие особенности:
Новорожденный мышечный ребенок фиксирован на том, что в животе у мамы было хорошо — все базовые потребности (есть, пить, спать, дышать) удовлетворялись на месте и сразу. После рождения для мышечника одни страдания — теперь все надо делать самому, самостоятельно. Отсюда для мышечного человека устойчивое желание в смерть как возврат в чрево матери. «Откуда пришел, туда и вернусь, в Матушку-землю».

В мышечности самый низкий страх смерти. При виде смерти мышечник приходит в возбуждение. В жизни порой не выдавишь ни слова, ни действия, а когда рядом с кем-то случится смерть – мышечник сразу чувствует себя хозяином положения! Знает все что нужно, что бы «похоронить по-человечески». Все делать любят «по-людски».

Довольствуется малым: если есть крыша над головой, и еда, то ни на что больше не претендует, непритязателен, неприхотлив. Ему можно не платить зарплату, забрать все сбережения, будет только бурчать.
Крайне миролюбив. Реагиурет яростью только на лишение самого основного (есть, пить, спать, дышать).

Мышечный вектор — это единственный вектор, который не ощущает своего «Я», «Мы» это закон в мышечном векторе: «Я как ВСЕ, как коллектив скажет. Мышечное «Мы» — делится на «мы-свои» и «мы-чужие». Разделение происходит по территориальному признаку. Одиночная камера для мышечника – страшная пытка, невыносимое страдание. Не способен к самостоятельному движению. Мышечник как глина, можно вылепить из него все что угодно, абсолютно ведомый.
Обладает крепким физическим здоровьем: «кровь с молоком» и огромной физической силой.
Получает удовольствие от мышечной работы, быстро и легко обрастает мышечной массой. Любит помогать там, где нужен тяжелый физический труд. Мышечный труд — это монотонный труд, 40 лет может вытачивать одну и ту же деталь, а если дадут вытачивать новую, какое-то время будем испытывать стресс.
Подозрительно относится к сексу. У мышечной женщины подозрительность к сексу в меньшей степени, чем у мышечного мужчины. Мышечная женщина создает основу, фундамент, рождая новое потомство. Именно она рожает по-настоящему: покосила траву, пошла, родила под стогом сена и пошла дальше косить. Рожает по 10 детей, чтобы была бОльшая вероятность выживания. У мышечного мужчины противоречие — между жизнью и смертью, которое, впрочем, легко разрешается через монотонную традицию и обряд: все чтоб как у людей было, по-людски. Когда не по-людски все, тогда — подозрительность, так как ломается программа…. не по-людски, это секс до брака, секс по-страсти, разрушающий монотонность. Мышечный мужчина не ходят по чужим бабам.

Убийство — суть мышечного вектора. Через смерть идет обновление жизни. Чтобы трава гуще росла, мы ее косим. Наше ЕПСД (есть, пить, спать, дышать — базовые потребности) обеспечиваются именно через убиийство: рушить горные породы — чтобы строить пещеры, рубить дрова — чтобы сохранить температуру тела, убивать животных -чтобы есть. При виде крови приходит в такое же возбуждение как при виде смерти. Именно мышечник препочитает покупать в магазине живую рыбу или птицу и убивать ее на собственной кухне.

Наиболее комфортный для мышечника ландшафт — деревня. Деревенская традиция — драки стенка на стенку под гармонь — это именно мышечная традиция, необходимая мышечнику для поддержания тонуса и боевого духа.

Гениально ориентируется в лесу без компаса (ср. кожник — гениально ориентируется в городе без карты).

Нереализованный мышечник
Отсутствие наслаждения в мышцах загоняет мышечника в невроз. Страдание фиксируется в минус свойства. Это лень и незнание собственной силы – чтобы не взял в руки, все ломается.
Реализованный вектор в современном обществе
Работник тяжелого физического труда.
Приблизительные профессиональные предпочтения: Рабочий, спортсмен-тяжеловес, охранник, животоновод, лесничий, комбайнер, строитель, телохранитель, грузчик, мясник, патологоанатом, могильщик.

Увлечения
Тренажерные залы, драки, кулачные бои.

Ключевое слово
Надо!

Мышечный вектор | Что у нас сегодня? События дня с точки зрения Системно-векторной психологии

Мышечный вектор – один из восьми векторов, изучаемых Системно-векторной психологией Юрия Бурлана. Вектор – это набор свойств и желаний, определяющих мышление, поведение и всю жизнь человека.

Люди, имеющие только мышечный вектор, отличаются простотой, бесконфликтностью и трудолюбием. Как правило, они рождаются в небольших поселениях и зачастую там и остаются жить. Не покидают свою родину. Ценность земли, на которой выросли, привычной еды – урожая со своего огорода – превосходит возможные удовольствия на чужбине. Именно мышечные люди делят людей на земляков (значит, своих) и чужаков.

Главная особенность людей с мышечным вектором – восприятие себя как причастного к коллективу, когда местоимение «мы» превалирует над «я». Поэтому одиночество для них несовместимо с жизнью, только в коллективе они чувствуют себя нормально.

Любовь к физическому труду

Название вектора говорит само за себя: физическая работа приводит людей с мышечным вектором в приятное, сбалансированное состояние. «У вас депрессия? Нужно вскопать огород», – считает представитель мышечного вектора. Потрудился, нагрузил мышцы, и так хорошо стало, что жизнь кажется прекрасной!

Мышление у обладателей мышечного вектора наглядно-действенное. Это означает, что в обучении нужно использовать показательный пример, а не пытаться объяснить словами. Это правило работает и при постановке задачи: для них лучше один раз увидеть, чем сто раз услышать.

Иногда таких людей называют конформными, или неимеющими своего мнения, собственной позиции. Но это не совсем верно. Носители мышечного вектора всегда несут идею группы людей, то есть перенимают ориентиры окружения, в котором находятся.

Выбор профессии

Профессии у мышечных людей самые простые, и при этом крайне нужные – это, прежде всего, строительство и ремонтные работы, работа на пашне, сбор урожая. Там, где нужна физическая сила. Деньги сами по себе не являются целью, сколько бы таким людям не дали за работу – они будут благодарны. Более того, именно они готовы работать бесплатно, так как сам процесс работы, нагрузка на мышцы – и есть их удовольствие. Даже «спасибо» не нужно.

Армия в основной своей массе состоит из рядовых-мышечников – никто другой не способен так легко расставаться с собственной жизнью в условиях войны. В голове такого человека нет места для торгов или сомнений, он делает то, что приказано командиром. Он – истинный воин! А в мирное время – строитель и родитель. Двенадцать собственных детей? Это не предел для семьи, где оба родителя – обладатели мышечного вектора.

При всей своей безобидности у мышечного челоевка есть личная зона, посягательства на которую он воспринимает крайне отрицательно. Это основные потребности – есть, пить, спать, дышать, сохранять приемлемую температуру тела, то есть соблюдать элементарные условия для сохранения жизни.

Самый распространенный вектор

Описанное выше относится к людям, имеющим только мышечный вектор. В больших городах их встретишь не часто. Тем не менее, мышечный вектор есть у 95 процентов людей. Однако в сочетании с другими векторами мышечность проявляется иначе. Мышечный вектор как бы «подстраивается» под другие вектора, усиливая их, делая «мощнее» другой нижний вектор – уретральный, кожный или анальный.

Наличие мышечного вектора обеспечивает здоровое тело и сильный иммунитет. Делает человека склонным к привычкам родного окружения, психической и физической «устойчивостью» по сравнению с теми, кто мышечный вектор не имеет.

Системно-векторная психология . Как воспитывать ребенка с мышечным вектором: простота во всем

Дети, обладающие исключительно мышечным вектором, практически никогда не рождаются в мегаполисах. Разве что в больших, многодетных семьях, которые проживают на окраинах. А вот в деревнях их много. Зачастую городские родственники считают их туповатыми и отсталыми, хотя на самом деле это совершенно не так. Да, сложные науки для них недоступны, но это совершенно не значит, что такой человек проживет жизнь чем-либо хуже других людей.

Сегодня люди с мышечным вектором (без других векторов) — это основа генофонда страны. В состоянии мира они — самые спокойные, самые неозлобленные, самые нетребовательные люди на свете. Тихие, без претензий — они легко живут даже самую трудную жизнь и не ропщут. Это они — соль земли, это они — создатели домов, это они — сельские работники, это они — солдаты, способные отдать жизнь за страну. Но только, если родители смогут развить их мышечный вектор. В обратном же случае из них вырастают никому не нужные люди, которые легко попадают под плохое влияние, а потом — в колонию или тюрьму. Как же правильно воспитывать мышечного ребенка?

Какой он, ребенок с мышечным вектором? И как его воспитывать?

Ребенка с мышечным вектором выделяет особенная психологическая интроверсия и желание быть, как все, быть со всеми. Они обычно немногословны и с удовольствием занимаются физическим трудом. Часто можно наблюдать таких детей в деревне, которые сидят на завалинке, едят семечки и перебрасываются ленивыми фразами. Со стороны может показаться, что они задумались и находятся в своих мыслях, но это не так — никаких особенных мыслей у них нет. Дети, а в будущем и взрослые, обладающие исключительно мышечным вектором, не отличаются желанием думать, мечтать, планировать жизнь. Они живут так, как живут. В самом лучшем смысле этих слов. Поэтому не удивительно, что любые умные вопросы им лучше не задавать. Потому что ответы у них получатся глупые. Не потому, что дети глупые, а потому что вопросы слишком умные. Только понимая это, можно понять настоящую психологию мышечного ребенка, не оценивая его через себя.

В классе всегда есть самый тупой ученик. Он сидит на задней парте, приносит хорошо выполненные домашние работы, которые очевидно дома помогают ему делать. Проблем с дисциплиной никаких. Но вот самостоятельные работы писать в классе ребенок не может. Читает с ошибками, не знает элементарных вещей. Если такой ребенок учится в обычном классе, другие дети начинают высмеивать его. Стоит учителю назвать его имя — как весь класс выжидательно поворачивается в его сторону, дети начинают отпускать издевательские замечания, хохочут над его ошибками. Это бывает на любом уроке и по любому предмету. Жизнь такого ребенка в обычной школе очень неприятна и некомфортна.

Если в деревне к таким детям относятся, как к нормальным, то в городе зачастую их относят к умственно отсталым деткам, вешая на них ярлык — дебил. Основан такой диагноз обычно бывает именно вследствие того, что ребенок плохо учится, ему не даются самые простые предметы в школе после 3-его класса, такие, как родной язык или арифметика. А при современных школьных программах, когда детям предлагается учиться все больше и больше, мышечные дети просто не имеют возможности показать себя с лучшей стороны. Не удивительно, что они — самые отсталые в классе. Учителя говорят, что они тупы и ленивы.

Обучение мышечного ребенка должно иметь наглядно-действенный формат.

Конечно, мышечный ребенок никогда не сможет стать профессором. Да у него и стремления такого никогда не будет. Но вот отличным рабочим, востребованным на рынке, он стать может. Но отлично он сможет делать свою работу только в том случае, если его не будут пичкать теоретическими знаниями, а возьмут и наглядно покажут, как, что и куда. Так, мышечная девочка в ПТУ быстро научится выпекать батоны или приобретет профессию маляра, а мальчик станет строителем. При хорошем учителе они станут работниками на вес золота — спокойными и безотказными. Более того, ни один умник с высшим образованием не сможет работать так, как они: без отдыха, с полной самоотдачей и за совершенно небольшую плату.



Мышечные дети очень сильные. Уже в детстве видно, что тело их как будто приспособлено к физическому труду. Мальчики-подростки, хотя и сильны от природы, не обладают тем, что в современном мире принято называть красивым телосложением (имея ввиду кожный вектор). Девочки не имеют утонченных рук с красивым запястьем. Наоборот, у них широкая кость, большие ладони.
Мышечные дети никогда не откажутся от физического труда, даже самого тяжелого. Их не остановит ни неприятный запах, ни отвратительная для другого человека обстановка. Они одинаково отнесутся к просьбе подмести двор или раскидать навоз по огороду. Родители должны повсеместно приучать их к такой работе — не стоит предлагать мышечнику лениться. Его наслаждение — это именно стимуляция собственных мышц и поэтому при правильном развитии, они, что говорится, могут работать до упаду.

Спорт — это увлечение и занятие НЕ для мышечных детей.

Может сложится впечатление, что такого ребенка необходимо отдать в спорт и он достигнет там больших результатов. Однако, все усилия тренеров и родителей будут тщетны — такой ребенок никогда не завоюет ни одной награды. В мышечном векторе совершенно нет желания соперничать и выигрывать, он не потенциален в спорте. Более того, спорт выводит мышечника из состояния монотонии и мира в состояние «война».

Все стремление к физическим нагрузкам у мышечного ребенка должно быть направленно именно на физический труд. Необходимо с самого раннего возраста брать его на полевые работы. Если мама целый день на огороде полет грядки, ребенок должен заниматься тем же. Если мама моет окна, дочка должна заниматься тем же. И так далее.



Мышечные дети обладают хорошим аппетитом. Они никогда не отказываются от еды и никогда не переедают. Еда им требуется самая простая и незатейливая.. Еще совсем недавно мышечные люди обходились еще меньшим пищевым рационом, при этом выполняя очень тяжелую работу.

Цитата из записей учительницы Хлебниковой, работавшей в середине 20-х гг. ХХ в. сельским учителем: «Ели щи из одной капусты и суп из одной картошки. Пироги и блины пекли один — два раза в год по большим праздника … При этом крестьянки гордились своей бытовой неграмотностью. Предложение добавлять что-то в щи для «скусу», они с презрением отвергали: «Неча! Мои и так жрут, да похваливают. А, эдак совсем разбалуешь»

Ни один мышечный человек не будет соблюдать диету, кушать маленькими порциями. Он ест до насыщения — ни больше, ни меньше.

Всегда давайте мышечному ребенку спокойно поесть. Не лезьте в его тарелку без разрешения.

Мышечному человеку очень неприятно, когда лезут в его тарелку, вырывают еду из рук. Никогда не стоит прерывать его трапезу. Предоставить ему достаточное количество времени, чтобы поесть. И точно так же в вопросе утоления жажды.

Вообще, не нужно делать какие-то резкие действия в основных мироощущениях ребенка. Давайте ему спокойно не только кушать и пить, но и спать. Нельзя резко будить мышечных детей — это может привести к вспышке ярости. Также не нужно навязчиво предлагать знакомиться с однолетками противоположного пола — это не приведет ни к чему хорошему.



Все мышечные люди очень сильно зависимы от окружения. Для них важно общее мнение. Мышечник никогда не пойдет против общественности. И, вследствие этого, он пойдет вместе со своим обществом всюду, даже на очень плохие дела. Как бы не сложилась жизнь мышечного человека, его мироощущение всегда будет «мы», и никогда — отдельное «я». А если у него спрашивать его личное мнение, то он ответит просто:

— А что я? Я — как все! Как все скажут, так и я думаю! Куда все, туда и я.

Быть как все, жить по-людски — это первичное, главное желание любого мышечного человека. Мышечный ребенок настолько привыкает к своему окружению, что фактически приобретает его ощущения. Если он попадет в хороший класс, где все друг друга поддерживают, по-доброму относятся к каждому в коллективе, и он таким же будет. Если он попадет в компанию к хулиганам, то сам очень быстро превратится в хулигана. И вытянуть его из этой компании уже не будет никакой возможности — она для него первична. И если все пойдут «на дело», он тоже пойдет, чтобы не отличаться.

Поэтому необходимо правильно подобрать для него учебное заведение, найти хорошего учителя, который сможет не просто передать ему знания по будущей специальности, а вырастит из него нормального человека. Выбирая ПТУ для мышечного ребенка необходимо набраться терпения и пообщаться с мастерами, обратить внимание на их способность формировать здоровый коллектив, общаться с детьми.



Мальчишеские драки — обычное дело для мышечных мальчиков. Сама природа создает их настоящими солдатами, которые в случае необходимости не пожалеют своей жизни для защиты родины.

Мышечный мальчик должен пройти испытание драками.

В детстве, подростковом возрасте и юношестве мышечные мальчики должны участвовать в драках. Пусть маму не пугают разбитый нос и порванные портки — это положительный опыт в жизни мальчишки, это необходимо для него. Драки позволяют мышечным детям прочувствовать силу своего удара, все свои физические способности.

Как только он пересек незримую черту, встречь ему двинулись сразу трое, в которых я узнал Ваньку Жукова и двух его дружков, Ваську Мягкова и Федьку Пчелинцева. Один из них, наскочив петухом, толкнул Мишу в грудь, провоцируя его на ответные действия…
– Бей его, ребята! – разнесся по озеру пронзительный Ванькин голос.
Тут уж и нам было не до нейтралитета.
– Наших бьют! – воинственно возгласил Гринька Музыкин и первым рванулся на выручку Миши (они жили по соседству). За Гринькою, подбадривая себя криками «ура», помчались и мы, непочетовские, и державшиеся нашей стороны завидовские мальчишки, и ребята с Денисовой улицы.
Михаил Алексеев «Драчуны»

В противном случае, взрослые мышечные люди становятся настоящими слонами в посудной лавке. Они не могут правильно рассчитать свои силы: вещи ломаются в их руках, другому человеку они случайно могут сломать руку.



Родители, которые помогут мышечному ребенку найти в современном мире свое, нужное место, обеспечат хорошую жизнь для своего потомка.

Внимание! Данная статья носит ознакомительный характер. Ребенок, кроме мышечного вектора, может обладать еще одним или несколькими векторами и в его воспитании надо учитывать также и другие вектора. О воспитании детей с другими векторами читайте здесь. Если Вы хотите полностью и абсолютно понимать своего ребенка и знать, как его воспитывать, пройдите тренинг по системно-векторной психологии Юрия Бурлана.

Мышечный вектор – послушно копает, послушно убивает

Младший Васька был 4-м ребенком в семействе Лебедевых. Проблем с ним до последнего времени не возникало никогда. С остальными было по-всякому. Двое старших сыновей и дочка все родились очень разными. Первенец Юрка – огонь, не удержишь, не остановишь, живет, словно, движимый, какой-то неведомой силой. Все в его руках горит, ничего не боится. Просто диву даешься, сколько в парне энергии.

Второй Сашка – тоже прыткий, но какой-то другой, с первым и не сравнишь. Он постоянно думает о своей выгоде, как бы где кого надуть. Оба учатся уже, вылетели из гнезда пташки. «Надеюсь, хоть Юрка присмотрит за ним. А то натворит ее Санек однажды дел, вечно что-то крутит, выдумывает. Ох, и натворит», — думала мать, глядя на своих взрослых отпрысков.

Катерина – третий ребенок в семье была девочкой красивой, статной, как мама в молодости. Широкая кость, белоснежная кожа с нежным румянцем, настоящая русская красавица. А хозяйка какая! Уже и сама по дому управляться могла, хоть замуж выдавай.

Троица, как всегда подшучивала над младшим. Васька то и дело слышал в свой адрес шуточки. Катя с Сашей всегда находили повод его зацепить. Только Юрка к Васе относился иначе, словно видел в нем нечто такое, о чем другие не догадывались, и вся Васькина простота около старшего брата куда-то испарялась, около него он даже приосанивался, и чем-то они становились невероятно похожи. Такие разные, они по не понятным причинам казались продолжением друг друга. Точнее Васька будто заражался Юркиной жизненной силой и ему передавалась капелька его невероятной харизмы.

Ну, ведь родные же братья, неудивительно, что у них столько общего. Мать смотрела на всех своих детей, которые дружно столпились около накрытого стола во дворе их большого деревенского дома и радовалась, что не смотря на все различия и разногласия, они все-таки приехали по ее просьбе. Она надеялась, что все вместе они смогут разрешить вопрос, который давно не дает ей покоя.

Васька – послушный мальчик с сюрпризом

Из всех ее детей, младший Василий был самым спокойным и беспроблемным ребенком. С ним легко было найти общий язык. Он легко соглашался выполнить любое поручение, не ожидая ни похвалы, ни награды за помощь по дому. Всегда бесхитростный и открытый. Главный вопрос, который волновал ее Васюту, чтобы обед был вовремя да много. Неприхотливый в еде, главное, что он любил – сытную, простую пищу. Любо-дорого посмотреть, как он уплетает кашу за обе щеки и всегда просит добавки.

Правда, его добротой частенько пользовались окружающие. Старая соседка Маруся, хитрая бабка, зная Васькин безотказный характер, всегда норовила затащить его к себе. То ей картошку копать тяжело – у нее спину ломит, то траву в огороде некому полоть. Вася не отказывался. Раз баб Марусь сказала надо, значит надо. Сильный не по годам он с самого детства любил помогать родителям по хозяйству. Любой физический труд был для него в радость.

В отличие от Кати, которая была уж очень обидчивой, и Саши, который без собственной выгоды и пальцем не хотел пошевелить, Вася находил общий язык только с Юрой. Старший брат всегда защищал самого младшего и не считал его простаком, не стеснялся брать в свою компанию, хотя разница в возрасте составляла 6 лет. Так уж вышло, что все ее дети родились с промежутком в два года.  

Жизнь шла своим чередом. Юрка первым выпорхнул из дома. В 17 он отправился покорять мир. И последние пять лет дома появлялся очень редко. Вот и сейчас мать специально просила его приехать. Потому что Васю, как ей казалось, надо было спасать.

После смерти отца, два года назад, а затем и отъезда из дома Саши, жизнь в их семье сильно поменялась. Но больше всего женщину беспокоило поведение Васи.

Поначалу появились прогулы в школе. Затем ее вызывали к директору, потому что Вася поломал беседку в школьном дворе. На первой же дискотеке, на которую он пошел с друзьями из новой компании, его и двух других ребят забрала милиция. Вася отличился больше всех – сломал нос соседскому мальчишке. Мать боялась, что в следующий раз ему несложно будет кого-нибудь и убить. С его-то силой.

Оказалась, что Вася общается с компанией ребят, которые на год-два старше его. Вместе с ними и прогуливает уроки. В один из вечеров, проведенных с друзьями, Вася вернулся домой пьяный. Да настолько, что двух слов связать не мог.

На все разговоры и крики матери, Васька односложно бубнил себе по нос:

— А чё я? Как все, так и я…

Он перестал, как прежде, помогать ей по хозяйству, после школы часто задерживался. Видя, что сын меняется прямо на глазах и боясь, как бы он под влиянием своей новой компании не пошел по кривой дороге, мать вызвала своих старших сыновей, чтобы все вместе они подумали, как поступить с Васей.

За полгода до этого она пыталась сама отвадить Васю от плохого влияния, записала его в единственный в их селе спортивный клуб, в секцию по борьбе, чтобы парень хоть чем-то увлекся и его не тянуло ни на выпивку, ни на дебоши, тогда он смог бы направить свою силу в правильное русло и не мерялся ею на дискотеках. Но занятия ожидаемой пользы не принесли. Наоборот, Вася словно решил отрабатывать новые навыки по борьбе на всех окрестных парнях. С началом его занятий, количество приводов в милицию значительно увеличилось. В этой ситуации совет старшего сына ей был просто необходим. Только на него и оставалась вся надежда, ведь не так давно Вася ловил каждое слово брата.

Ваську отправили спать рано. Юра только бровью повел, чтобы Вася беспрекословно выполнил указание. Перечить старшему было себе дороже. Он хоть и любил Васю, но свой характер в свое время показал еще отцу и даже тот признавал за ним право голоса.

Мать хотела поговорить со старшими сыновьями о Васе и спросить у них совета, что же делать с мальчиком дальше. Простодушный и легко управляемый он все сильнее поддавался влиянию плохой компании. А на носу был конец учебного года. Мать боялась, что летом от безделья и скуки Вася попадет в какую-нибудь беду.

Юрка долго не думал:

— Я заберу его с собой. Будет учиться. Все будет нормально, мам. Не беспокойся. Я за ним присмотрю.

Когда за дело брался Юра, мать знала, что, несмотря на его пыл и горячность, на него все-таки можно было положиться.

— А если он не захочет учиться? Вася и так с большим трудом год окончил. Даже не знаю, что из этого выйдет, боюсь его в большой город отпускать.

Но Юрина уверенность быстро передалась и женщине. Старший точно сделает из младшего человека, сама-то она больше не в силах ничего предпринять.

Еще две недели все ее дети провели дома. За этот короткий срок Вася уже успел измениться. Он снова попал под крыло старшего брата. И ни разу не вспомнил о своих школьных друзьях. Словно привязанный он ходил по пятам за Юркой и с радостью воспринял известие об отъезде вместе с ним.

Учебное заведение было выбрано быстро. Юра сам все решил. Вася был просто поставлен перед фактом, чему он, впрочем, совершенно не противился.

ПТУ, так ПТУ. Профессию для жизни, там можно выбрать что надо. Всегда пригодится и работу найти не сложно. Рабочие руки нужны везде и всюду. А работником Вася может быть очень хорошим.

3 года спустя

В доме пахло жареными пирожками, душистой бараниной и квашеной капустой. На столе дымился только что вытащенный из печки картофель. С минуты на минуту домой должны были приехать ее мальчики и Катенька. Ну, Юрка как всегда не сможет. Его каким-то ветром занесло аж в Америку. А Саша, Вася и Катя не могли не навестить мать в ее день рождения.

Детки приехали все вместе на Сашиной машине. Он был страшно горд, что смог наконец заработать на собственный автомобиль.

За столом много говорили о Юре. С тех самых пор он дома так и не показался. Но обещание свое выполнил. Под руководством старшего брата Вася поступил в училище.. Все три года учебы Вася исправно посещал занятия, выбранное направление ему нравилось, и привыкший исполнительно выполнять все задания он окончил его хорошо. Пришло время найти работу и быть как все…

Как все, так и я — мышечный вектор – спокойный ребенок с «сюрпризом»

«Как все» — основополагающее состояние человека, обладающего мышечным вектором.

Природой на людей этого типа психического возложена базовая роль по продолжению человеческого рода. Это основа основ – демография и одновременно с этим создание самых простых и необходимых условий для жизнеобеспечения и развития человечества.

Строить дома, пахать поля, рожать детей – три главные вещи, без которых не может обойтись общество. И именно люди с мышечным вектором справляются с этой задачей лчше других. Они неприхотливы, их желания просты и связаны с обеспечением базовых потребностей. Мышечники являются преимущественно жителями деревень, не стремятся покорять большие города, в их семьях рождается по 5-6 детей и трудятся они в основном в области сельского хозяйства, всегда предпочитая быть ближе к земле.

Мышечные люди рожают, кормят, строят, живя монотонной, обыденной жизнью, которой счастливы, покуда у них есть крыша над головой и кусок хлеба на столе.

Ребенок с мышечным вектором, этакий простодушный Вася, беспрекословный и неконфликтный; научите его копать, и он будет копать. Научите носить воду из колодца, будет носить. Наделенный от природы большой физической силой, словно настоящий русский богатырь из старой былины, он с самого детства приспособлен к труду.

Природой задумано так, что для выполнения своей видовой роли каждый человек наделен соответствующими желаниями. Так и мышечник, чья роль обеспечивать человечество базовыми элементами вживания, получает удовольствие от ее выполнения. Поэтому физический труд, во время которого хорошо задействованы все мышцы тела, приносит удовольствие и дается легко и спокойно.

Мышечный ребенок с детства будет получать удовольствие от элементарной работы в саду или огороде. Но родителям необходимо приучить его к этому. По своей природе мышечный взрослый или ребенок безынициативен. Его необходимо направить. Он не будет противиться или упираться, не потребует платы и не спросит «а что мне за это будет», не станет ждать слов благодарности, сам труд и физическое напряжение – для него уже награда, потому что во время него он задействует свою эрогенную зону – мышцы.

У обладателя мышечного вектора – нет особых запросов. Сытная пища и хороший сон – все, что требуется ему для нормального расположения духа. Ведь ничего другого и не нужно, чтобы поутру вновь встать и заняться своим делом.

Поэтому в семье, где есть дети с другими векторами, чьи природные задачи иные, мышечного ребенка будет считать простачком или вовсе дураком. Не понимая мышечный вектор, сложно осознать, что его физический труд – благородное дело, а не единственное занятие по причине обделенности прочими талантами.

Природа всегда считает до двух: мужчина и женщина, день и ночь, мирное время и война. Роль мышечников в мирное время – хлеборобы и комбайнеры, плотники и монтажники. Но если наступает необходимость защищаться или нападать, мышечник буквально перевоплощается. А точнее принимает форму того, кто его ведет. И прежде бездейственный и безынициативный, всегда монотонный, человек с мышечным вектором перенимает образ действия своего командира. Если это уретральный вожак – горячий, и неудержимый, таким же окажется и войско мышечный воинов, стоящих за ним.

Война – означает не только поле брани и солдат в окопах. В современных условиях общества состояние «война» означает не буквально воинственный настрой, а тот «окрас» который приобретают все свойства вектора и формируют жизненный сценарий. Например, кожник в состоянии «война» — бизнесмен, зрительница в состоянии «мир» — воспитатель и учитель. А мышечному парню совсем не обязательно записываться наемником в армию для того, чтобы войти состояние «война», достаточно попасть в соответствующую компанию, беда в том, что непосредственно вне военных действий такой жизненный сценарий для него губителен.

Для мышечного подростка наихудшее окружение – это неразвитые обладатели кожного вектора, склонные выпивать, приворовывать, чужими руками загребать то, что плохо лежит. Попадая под влияние архитипичного кожника, мышечный ребенок или взрослый мужчина быстро научается поступать «как все». И его легко направить на преступление, особенно под воздействием алкоголя. Тем более мышечник, обладающий большой физической силой, он без особых усилий может покалечить или убить, не сумев рассчитать силу своего удара.

По этой же причине опасны занятия спортом, любыми видами единоборств, становящиеся для него заменителем войны и требующие применить свои навыки на практике.

Единственный правильный метод воспитания мышечного ребенка – это приучение его с самого детства к физическому труду. Способный получать от него удовольствие, он и в дальнейшей жизни будет способен трудиться в соответствующих ему областях, не попадая под чужое негативное влияние и не спиваясь.

Статья написана с использованием материалов тренингов по системно-векторной психологии Юрия Бурлана

Автор Ольга Чугурян

Мышечный вектор. Конспект свойств. — Системно Векторная Психология

Численность
38 % в стае в чистом виде.
в смешении с другими векторами намного больше — примерно всего 3-5 % людей в современном мире без мышечности.

Архетип
фундаментальная масса живого вещества.

Видовая роль
воин, охотник.

Общая характеристика: 
а) цвет наибольшего комфорта – черный
б) геометрия наибольшего комфорта – прямоугольник, кирпич;
в) место в квартели – внутренняя часть квартели ПРОСТРАНСТВО, интроверт;
г) тип мышления – наглядно-действенное.

Внешние признаки:
Рост высокий. Телосложение крупное.
Устойчивый (про такого говорят: «Крепко на земле стоит»). Сильный.
Тело с выраженным мышечным рельефом.
Широкая, толстая шея.

Особенности психики:
В основе всех психических процессов лежит монотония.
Идеально адаптирует ландшафт: внутреннее мышечное «Мы» — наиболее совершенное состояние психики для животного выживания на ладшафте, однако буквально врастая в ландшафт, испытывает колоссальное мучение при его смене, так как не способен к адатации нового ландшафта, не приспособлен к перемене своего
монотонного образа жизни.
Живут по принципу: как научат. Этот принцип работает в мышечности абсолютно во всем!
Психология массы, толпы.

Жизненные ценности:
Труд.
Сила.
Смерть в бою.

Личностные качества
Неприхотливость. Непритязательность.
Миролюбивостью.
Выносливость.
Низкая эмоциональная амплитуда.

Особенности речи:
Говорит мало, односложно.

Характеристики, поведенческие особенности:
Новорожденный мышечный ребенок фиксирован на том, что в животе у мамы было хорошо — все базовые потребности (есть, пить, спать, дышать) удовлетворялись на месте и сразу. После рождения для мышечника одни страдания — теперь все надо делать самому, самостоятельно. Отсюда для мышечного человека устойчивое желание в смерть как возврат в чрево матери. «Откуда пришел, туда и вернусь, в Матушку-землю».

В мышечности самый низкий страх смерти. При виде смерти мышечник приходит в возбуждение. В жизни порой не выдавишь ни слова, ни действия, а когда рядом с кем-то случится смерть – мышечник сразу чувствует себя хозяином положения! Знает все что нужно, что бы «похоронить по-человечески». Все делать любят «по-людски».

Довольствуется малым: если есть крыша над головой, и еда, то ни на что больше не претендует, непритязателен, неприхотлив. Ему можно не платить зарплату, забрать все сбережения, будет только бурчать.
Крайне миролюбив. Реагиурет яростью только на лишение самого основного (есть, пить, спать, дышать).

Мышечный вектор — это единственный вектор, который не ощущает своего «Я», «Мы» это закон в мышечном векторе: «Я как ВСЕ, как коллектив скажет. Мышечное «Мы» — делится на «мы-свои» и «мы-чужие». Разделение происходит по территориальному признаку. Одиночная камера для мышечника – страшная пытка, невыносимое страдание. Не способен к самостоятельному движению. Мышечник как глина, можно вылепить из него все что угодно, абсолютно ведомый.
Обладает крепким физическим здоровьем: «кровь с молоком» и огромной физической силой.
Получает удовольствие от мышечной работы, быстро и легко обрастает мышечной массой. Любит помогать там, где нужен тяжелый физический труд. Мышечный труд — это монотонный труд, 40 лет может вытачивать одну и ту же деталь, а если дадут вытачивать новую, какое-то время будем испытывать стресс.
Подозрительно относится к сексу. У мышечной женщины подозрительность к сексу в меньшей степени, чем у мышечного мужчины. Мышечная женщина создает основу, фундамент, рождая новое потомство. Именно она рожает по-настоящему: покосила траву, пошла, родила под стогом сена и пошла дальше косить. Рожает по 10 детей, чтобы была бОльшая вероятность выживания. У мышечного мужчины противоречие — между жизнью и смертью, которое, впрочем, легко разрешается через монотонную традицию и обряд: все чтоб как у людей было, по-людски. Когда не по-людски все, тогда — подозрительность, так как ломается программа…. не по-людски, это секс до брака, секс по-страсти, разрушающий монотонность. Мышечный мужчина не ходят по чужим бабам.

Убийство — суть мышечного вектора. Через смерть идет обновление жизни. Чтобы трава гуще росла, мы ее косим. Наше ЕПСД (есть, пить, спать, дышать — базовые потребности) обеспечиваются именно через убиийство: рушить горные породы — чтобы строить пещеры, рубить дрова — чтобы сохранить температуру тела, убивать животных -чтобы есть. При виде крови приходит в такое же возбуждение как при виде смерти. Именно мышечник препочитает покупать в магазине живую рыбу или птицу и убивать ее на собственной кухне.

Наиболее комфортный для мышечника ландшафт — деревня. Деревенская традиция — драки стенка на стенку под гармонь — это именно мышечная традиция, необходимая мышечнику для поддержания тонуса и боевого духа.

Гениально ориентируется в лесу без компаса (ср. кожник — гениально ориентируется в городе без карты).

Нереализованный мышечник
Отсутствие наслаждения в мышцах загоняет мышечника в невроз. Страдание фиксируется в минус свойства. Это лень и незнание собственной силы – чтобы не взял в руки, все ломается.
Реализованный вектор в современном обществе
Работник тяжелого физического труда.
Приблизительные профессиональные предпочтения: Рабочий, спортсмен-тяжеловес, охранник, животоновод, лесничий, комбайнер, строитель, телохранитель, грузчик, мясник, патологоанатом, могильщик.

Увлечения
Тренажерные залы, драки, кулачные бои.

Ключевое слово
Надо!

Просмотров: 220

Поделитесь этим с другими:

Мышечный вектор | Блог Владимира Тычинского

Приветствую, уважаемый читатель!

Темой сегодняшнего поста послужит мышечный вектор. Он заслуживает нашего внимания уже хотя бы потому, что является самым распространенным среди всех восьми! Вы правильно предположили, что каких-то необычных особенностей у самого массового вектора быть не может, но, тем не менее, носители этого вектора играют значительную роль в функционировании любого общества.

Для людей мышечного вектора “МЫ” в любой ситуации важнее чем “Я”. Бесхитростные, преданные, скромные и неприхотливые, “мышечники” ощущают свою “нужность” только в роли “детали единого механизма”, не испытывая при этом дискомфорта от нереализованности своей индивидуальности. Правильней будет сказать, что реализованность для них и есть выполнение работы важной для всех.

Люди мышечного вектора. Отличительные особенности.

Распознать “мышечника” довольно просто по атлетическому телосложению, широким плечам и таким же широким, размашистым движениям. Мимика и жестикуляция носителей этого вектора если не скудна, то крайне небогата. Речь неторопливая, не изобилующая разного рода оборотами. Иногда ощущается, что “мышечник” подбирает необходимое слово, часто использует междометия — паразиты.

В выборе одежды люди мышечного вектора неприхотливы. Следование моде не для них. Главное требование к новой вещи при пополнении гардероба — прочность, удобность и свободность.

По внешним проявлениям можно подумать, что люди данного вектора просто “тугодумы”, но это далеко не так. О том как строить отношения с “мышечником” ниже.

 

Общение с людьми мышечного вектора

Одно из самых явно выраженных качеств “мышечника” — тяга к обществу, стремление работать
в команде, при этом получать четкие недвусмысленные инструкции и распоряжения. “Мышечнику” по душе даже монотонная физическая работа, за которую другие не берутся.

Людям мышечного вектора свойственна настоящая корпоративная преданность — эти люди становятся рьяными патриотами компании. Им искренне нравится много работать, “отдаваясь” работе целиком, преодолевая вместе с коллегами все трудности и невзгоды.

Если среди ваших коллег или подчиненных есть “мышечники”, то в общении с ними стоит избегать излишних мудрствований, все объяснения старайтесь давать более наглядно и, главное, не лишайте их возможности трудиться в группе — индивидуальная работа (равно как индивидуальная ответственность) им мало подходят.

Важно отметить, что приведенное описание подходит к носителям явно доминирующего мышечного вектора. Другим людям присутствие этого вектора в их векторальном наборе просто придает жизненных сил, выносливости и энергии.

В следующий раз поговорим о векторе Лидеров и Вождей, Первопроходцев и Бунтарей — уретральном векторе!

До встречи!

 Кожный вектор

Системно-векторная психология

Бизнес по законам природы

 

Сохранение в мышцах аденовирусного вектора, в котором отсутствуют все вирусные гены

Генетическая коррекция наследственных мышечных заболеваний, таких как мышечная дистрофия Дюшенна, потребует долговременной экспрессии рекомбинантного белка после переноса гена. Ранее мы показали, что новый аденовирусный вектор, в котором отсутствуют все вирусные гены, экспрессировал как полноразмерный дистрофин, так и β-галактозидазу в мышцах мышей mdx (с дефицитом дистрофина). Мы наблюдали значительное гистологическое улучшение трансдуцированной вектором мышцы mdx до возможной потери экспрессии трансгена, кодируемого вектором.В этом исследовании мы исследовали, вносит ли иммунологический ответ против кодируемой вектором β-галактозидазы вклад в потерю экспрессии вектора и влияет ли на его устойчивость в мышцах. Внутримышечная инъекция вектора контрольным нормальным мышам приводила к ранней и полной потере экспрессии β-галактозидазы, сопровождаемой преимущественно лимфоцитарной инфильтрацией CD4 + и CD8 + и значительной потерей векторной ДНК. Напротив, внутримышечная инъекция вектора трансгенным мышам lacZ приводила к устойчивой экспрессии β-галактозидазы в течение по меньшей мере 84 дней без признаков воспаления или значительной потери векторной ДНК. Наши исследования демонстрируют, что в отсутствие иммунного ответа, индуцированного экспрессией β-галактозидазы, аденовирусный вектор, лишенный всех вирусных генов, стабильно сохраняется в мышцах.

Мышечная дистрофия Дюшенна (МДД) — это Х-сцепленное летальное заболевание скелетных мышц, при котором повреждение и дегенерация мышечных волокон происходит из-за отсутствия белка дистрофина в мышечной мембране (1, 2). Соматический перенос гена кДНК дистрофина может обеспечить функциональный белок дистрофина мышечным волокнам, спасая их от повторяющихся циклов дегенерации.Лечение наследственных нарушений, связанных с недостаточностью, таких как МДД, с помощью переноса соматического гена потребует стойкой экспрессии терапевтического белка.

Аденовирусные векторы считаются хорошими кандидатами для переноса соматических генов в мышцы из-за их способности трансдуцировать постмитотические клетки (3, 4). В исследованиях на животных аденовирусные векторы с дефектом репликации использовались для переноса генов, кодирующих маркерные белки (5), секреторные белки (6-8) и укороченные формы дистрофина в мышцы (9-14). Опосредованные Т-клетками и В-клеточные иммунные ответы на аденовирусные векторы первого поколения наблюдались в различных тканях, включая скелетные мышцы (7). Эти иммунные ответы индуцируются как вирусными белками, так и трансгенными мишенями. Исследования аденовирусных векторов первого поколения на генетически модифицированных мышах с иммунодефицитом или мышах с системной иммуносупрессией подтвердили гипотезу о том, что основным ограничением устойчивости аденовирусного вектора первого поколения в мышцах является иммунный ответ на вектор и продуцируемые им белки ( 7, 15, 16).Однако относительная важность иммунного ответа на трансген по сравнению с вирусными белками, экспрессируемыми из аденовирусных векторов первого и второго поколения, не была определена. Еще одним ограничением использования аденовирусных векторов первого или второго поколения для переноса кДНК дистрофина размером 14 т.п.н. является их максимальная емкость вставки, составляющая всего 8 т.п.н. (17).

Чтобы решить проблемы ограниченной емкости вставок и продукции потенциально иммуногенных вирусных белков аденовирусными векторами первого или второго поколения, мы и другие разработали аденовирусные векторы, которые упаковывают 30 т. п.н. чужеродной ДНК и не имеют вирусных генов (18–21) .Наш вектор, AdDYSβgal, имеет вставку чужеродной ДНК, состоящую из полноразмерной кДНК мышиного дистрофина, управляемой мышечным промотором, и гена Escherichia coli lacZ , управляемого немедленным ранним промотором цитомегаловируса человека (CMV) (18). AdDYSβgal продуцируется с помощью вспомогательного вируса, который обеспечивает необходимые вирусные функции путем дополнения trans . Очистка вектора с помощью бэндинга с хлоридом цезия оставляет уровень вируса-помощника в очищенном запасе AdDYSβgal на уровне 1% или менее.

Мы продемонстрировали эффективную трансдукцию мышечных клеток с помощью AdDYSβgal, обеспечивающего дистрофин и β-галактозидазу in vitro (18) и in vivo (22). Наше исследование in vivo показало, что экспрессия дистрофина и β-галактозидазы из AdDYSβgal увеличивалась со временем после внутримышечной инъекции вектора мышам mdx и достигла пика через 28 дней после инъекции. Гистологический фенотип трансдуцированной мышцы был значительно улучшен с уменьшением количества волокон, содержащих централизованные ядра (22).Однако через 42 дня после инъекции доля мышечных волокон, экспрессирующих оба гена, уменьшилась. В этом отчете мы рассматриваем вопрос о том, способствовал ли иммунный ответ, индуцированный продуктом маркерного гена, β-галактозидазой, снижению экспрессии вектора и влиял на его устойчивость в мышцах.

МАТЕРИАЛЫ И МЕТОДЫ

Животные.

Гомозиготных самцов трансгенных мышей lacZ , экспрессирующих β-галактозидазу с ядерной локализацией под контролем промотора и энхансера 3F легкой цепи миозина, специфичных для мышц (23), скрещивали с самками нормальных мышей Swiss Webster.Гетерозиготное трансгенное потомство lacZ , которое использовали для инъекций AdDYSβgal, экспрессировало β-галактозидазу в ядрах мышечных волокон, что должно обеспечивать иммунную толерантность к чужеродному белку-маркеру. Контрольные нормальные мыши, коизогенные по отношению к трансгенным мышам lacZ , за исключением трансгена lacZ , не экспрессировали β-галактозидазу, и ожидалось, что они будут иммунореактивны по отношению к маркерному белку. Этих мышей скрещивали с самками мышей Swiss Webster, чтобы получить контрольных мышей для наших исследований.

Получение аденовирусного вектора AdDYSβgal.

AdDYSβgal (18) содержал кассету экспрессии, состоящую из двух частей: ( i ) полноразмерную кДНК мышиного дистрофина под контролем промотора мышечной креатинкиназы мыши, включая первый интрон (24) и ( ii ) Ген lacZ E. coli под контролем раннего промотора CMV человека (25). После размножения в клетках 293 с помощью вируса-помощника AdDYSβgal очищали в трех последовательных равновесных градиентах хлорида цезия.Очищенную полосу диализовали против двух замен PBS 2+ (0,137 М NaCl / 2,7 мМ KCl / 10,1 мМ Na 2 HPO 4 / 1,7 мМ KH 2 PO 4 / 0,4 мМ CaCl 2 / 0,5 мМ MgCl 2 , pH 7,4), содержащий 5% глицерина. Титр вектора определяли путем инфицирования клеток 293 до предельного разведения и окрашивания через 18 ч на β-галактозидазу. Загрязнение очищенного векторного препарата вирусом-помощником, как определено с помощью анализа бляшек и саузерн-блоттинга выделенной ДНК, составляло 1% или менее.

Внутримышечная инъекция AdDYSβgal.

Четырехдневным трансгенным мышам lacZ или нетрансгенным мышам вводили однократную 5 мкл внутримышечной инъекции 2 × 10 7 AdDYSβgal инфекционных частиц в задний отдел правой задней ноги. Такой же объем PBS 2+ вводили в задний отдел левой задней лапы. Мышей умерщвляли через 14, 28, 42, 63 и 84 дня после инъекции. После удаления левую и правую икроножные мышцы погружали в 4% параформальдегид в PBS (0.137 M NaCl / 2,7 мМ KCl / 10,1 мМ Na 2 HPO 4 / 1,7 мМ KH 2 PO 4 , pH 7,4) при 4 ° C в течение 8 часов, промывка PBS, криопротекция 30% сахарозы , а затем мгновенно замораживают в изопентане, охлаждаемом жидким азотом.

Обнаружение β-галактозидазы в криосрезе мышц.

Мышечные блоки делали криосрезы толщиной 10 мкм. Срезы промывали PBS при комнатной температуре в течение 15–30 мин с двумя заменами и гистохимически окрашивали 5-бром-4-хлор-3-индолил β-d-галактозидом (X-Gal) (0.1% X-Gal в 5 мМ феррицианиде калия, 5 мМ ферроцианиде калия и 2 мМ MgCl 2 ,) при 37 ° C в течение 12–16 часов. Криосрезы, взятые из середины каждого мышечного блока для ограничения вариабельности из-за векторной инъекции, были проанализированы с помощью программного обеспечения для анализа изображений mcid (Imaging Research, St.Catherine’s, ON, Canada), связанного с аксиофотическим микроскопом Zeiss для количественного определения отношения площадь поперечного сечения, экспрессирующая β-галактозидазу, по отношению к общей площади поперечного сечения мышечного сечения. Серийные срезы, окрашенные гематоксилином и эозином, анализировали для определения общей площади поперечного сечения мышц. Отношения были выражены в процентах.

Обнаружение CD4

+ и CD8 + Т-клеток в мышечных криосрезах.

Криосрезы мышц промывали PBS при комнатной температуре в течение 15–30 минут, а эндогенную пероксидазу блокировали реагентом, блокирующим пероксидазу (DAKO), в течение 5 минут при комнатной температуре. Срезы промывали PBS, блокировали 10% козьей сывороткой в ​​PBS в течение 1 ч, а затем инкубировали с крысиными антимышиными CD4 (номер клона RM4-5, PharMingen) и CD8a (номер клона 53-6.7, PharMingen) моноклональные антитела в течение ночи при комнатной температуре. Срезы промывали 10% козьей сывороткой в ​​PBS, а затем инкубировали с биотинилированным козьим вторичным антителом против крысы в ​​течение 1 часа. Срезы промывали 10% козьей сывороткой в ​​PBS, как и раньше, инкубировали с реагентами Avidin DH и биотинилированной пероксидазой H хрена (набор Vectastain Elite ABC, Vector Laboratories) в течение 30 минут, а затем промывали PBS. Включенная пероксидазная активность была локализована с помощью тетрагидрохлорида диаминобензидина (набор субстратов DAB для пероксидазы, Vector Laboratories).

Обнаружение макрофагов в криосрезе мышц.

Препараты криосрезов мышц дважды промывали PBS при комнатной температуре в течение 15–30 мин. Срезы блокировали 10% козьей сывороткой в ​​PBS в течение 1 часа, а затем инкубировали с кроличьими антителами против макрофагов мыши (Axell), конъюгированными с флуоресцеинизотиоцианатом (Axell), в течение 1 часа при комнатной температуре.

Выделение мышечной ДНК.

Каждый образец, состоящий из 20 криосрезов фиксированной параформальдегидом мышечной ткани (10 мкм на срез), расщепляли 200 мкг протеиназы К на мл в 50 мМ Трис · HCl (pH 8.0) / 10 мМ ЭДТА (pH 8,0) / 0,5% SDS при 55 ° C в течение 6–16 часов. Образец ДНК очищали фенол-хлороформной экстракцией и осаждением этанолом.

ПЦР-количественное определение векторной ДНК.

Стандартная ПЦР с использованием ДНК-полимеразы Taq была модифицирована для полуколичественного определения ДНК AdDYSβgal (26). Вкратце, 100 нг образца ДНК, экстрагированного из lacZ трансгенной и нетрансгенной мышцы мыши после внутримышечной инъекции AdDYSβgal, амплифицировали с двумя парами праймеров.Одна пара праймеров, 5′-TTGGAAAGCAACACATAGACAACC-3 ‘и 5′-TTCACTGTTGGTTTTGCTGCAATCC-3′, была использована для амплификации ДНК между нуклеотидами 315 и 608 кДНК мышиного дистрофина (номер доступа в GenBank M6885YS-319-M6885Yβ), давая a AdBank 319gD6885 в AdBank. Продукт ПЦР. Другая пара, 5’-TGAGACCCCTACCCTTGCAATACG-3 ‘и 5′-CATGTTAATGGTGACTACCCCGTC-3’ (26), была специфична для однокопийного гена адипсина мыши, давая продукт ПЦР длиной 191 п.н. В контрольных экспериментах 100 нг неинъецированной мышечной ДНК мыши смешивали с очищенной плазмидной ДНК pDYSβgal (18) в концентрации, соответствующей 0.5, 0,1, 0,05, 0,01, 0,005 копий на клетку и амплифицировали параллельно, чтобы получить стандартную кривую. Реакции ПЦР проводили в 50 мкл, содержащих 10 мМ Трис · HCl (pH 8,3), 500 мМ KCl, 200 мкМ каждого дезоксинуклеотидтрифосфата и 2,5 единиц ДНК-полимеразы Taq , с 50 пмоль каждого праймера, описанного выше. Амплификацию проводили в течение 25 циклов при 95 ° C в течение 30 с, 55 ° C в течение 1 минуты, 72 ° C в течение 1 минуты с последующим однократным удлинением при 72 ° C в течение 8 минут. Аликвоты по 7 мкл из ПЦР-амплификации разделяли электрофорезом на 1.5% агарозный гель, перенесенный на нейлоновую мембрану Nytran plus (Schleicher & Schuell) и сшитый УФ-излучением с использованием страталинкера (Stratagene). Блот анализировали на дистрофин и адипсин с помощью саузерн-блоттинга. Стандартная кривая плазмидной ДНК pDYSβgal была линейной в диапазоне 0,01–0,5 копий на ядро. Обнаружение векторных полос было выполнено с помощью случайного праймированного 32 P-меченного Spe I фрагмента кДНК мышиного дистрофина, содержащего нуклеотиды 1–1441. Обнаружение полосы адипсина было достигнуто с помощью 32 P-меченного ПЦР-продукта, полученного с использованием праймеров, описанных выше.Мембрану предварительно гибридизовали при 65 ° C в течение 3 ч в 6 × SSPE (0,9 M NaCl / 60 мМ NaH 2 PO 4 , pH 7,4 / 6 мМ EDTA, pH 8,0) / 0,1% SDS / 5 × раствор Денхардта. / 200 мкг денатурированной ДНК спермы лосося на мл. Затем мембрану гибридизовали в том же растворе с зондом дистрофина, меченным 32 P. Мембрану дважды промывали при комнатной температуре (каждый раз по 5 минут) 2 × SSPE / 1% SDS и один раз при 50 ° C 0,2 × SSPE / 0,1% SDS в течение 30 минут. Затем мембрану экспонировали с пленкой Kodak XAR для получения фотографического изображения, и результаты Саузерн-блоттинга количественно оценивали с помощью анализа PhosphorImager на сканере (Molecular Dynamics).Затем блот отделяли и аналогичным образом анализировали на адипсин.

РЕЗУЛЬТАТЫ

Пролонгированная экспрессия β-галактозидазы из инъецированного вектора AdDYSβgal у трансгенных мышей

lacZ .

Чтобы проверить гипотезу о том, что экспрессия β-галактозидазы из вектора может вызывать иммунный ответ, приводящий к устранению мышечных волокон, экспрессирующих этот белок, мы вводили вектор в икроножную мышцу 4-дневных мышей, толеризованных к β-галактозидазе. .Эти мыши имеют трансген lacZ , модифицированный сигналом ядерной локализации под контролем мышечно-специфичного промотора и энхансера легкой цепи миозина 3F (23). Локализованная в ядре β-галактозидаза, экспрессируемая из трансгена, была легко отличима от цитоплазматической β-галактозидазы, экспрессируемой из вирусного вектора (рис. 1). Параллельные внутримышечные инъекции вектора проводили коизогенным нетрансгенным мышам соответствующего возраста, которые не были толеризованы к β-галактозидазе.

Экспрессия и локализация β-галактозидазы в lacZ трансгенных и нетрансгенных мышцах контрольной мыши.( A ) Поперечное сечение имитационной инъекции икроножной мышцы трансгенной мыши lacZ показывает β-галактозидазу, локализованную в ядрах мышечных волокон. У этих мышей трансген lacZ с сигналом, локализующим ядро, экспрессируется под контролем мышечно-специфичного промотора и энхансера легкой цепи миозина 3F. ( B ) Поперечное сечение икроножной мышцы трансгенной мыши lacZ , получившей внутримышечную инъекцию AdDYSβgal.Кодируемая вектором β-галактозидаза локализуется в цитоплазме. ( C ) Поперечный разрез имитационной инъекции икроножной мышцы контрольной нетрансгенной мыши. ( D ) Поперечный разрез икроножной мышцы контрольной мыши, получившей внутримышечную инъекцию AdDYSβgal. Кодируемая вектором β-галактозидаза локализуется в цитоплазме. (× 80).

Мышечную экспрессию цитоплазматической β-галактозидазы наблюдали у трансгенных и нетрансгенных мышей lacZ в течение до 84 дней после внутримышечного введения AdDYSβgal.Репрезентативные срезы трансгенной и нетрансгенной мышцы lacZ через 14, 28 и 42 дня после инъекции показаны на рис. 2. Уровень экспрессии β-галактозидазы оценивался как отношение площади поперечного сечения мышцы, экспрессирующей β-галактозидазу. к общей площади поперечного сечения мышцы и выражалась в процентах (рис. 3). На 28 день экспрессия β-галактозидазы наблюдалась в 23–27% площади поперечного сечения мышц как у трансгенных, так и у нетрансгенных мышей lacZ .У трансгенных мышей lacZ цитоплазматический уровень экспрессии β-галактозидазы оставался постоянным до 63 дней после инъекции; однако через 84 дня наблюдалось уменьшение площади поперечного сечения до 10%. Напротив, нетрансгенные мыши показали значительную потерю экспрессии β-галактозидазы уже через 42 дня после инъекции. У двух из трех мышей полная потеря экспрессии β-галактозидазы наблюдалась через 42 дня. Экспрессия β-галактозидазы из вектора не была обнаружена ни у каких нетрансгенных мышей, обследованных через 84 дня после инъекции.

Экспрессия кодируемой вектором β-галактозидазы связана с воспалением в нетрансгенной, но не lacZ трансгенной мышце мыши. ( A , E и I ) lacZ мышца трансгенной мыши через 14, 28 и 42 дня после внутримышечной инъекции AdDYSβgal, окрашенной X-Gal. ( B , F и J ) Последовательные срезы A , E и I , окрашенные гематоксилином и эозином, не показывают воспалительного клеточного инфильтрата.( C , G и K ) Нетрансгенная мышца мыши через 14, 28 и 42 дня после внутримышечной инъекции AdDYSβgal, окрашенная X-Gal. ( D , H и L ) Серийные срезы C , G и K , окрашенные гематоксилином и эозином, показывают воспалительный клеточный инфильтрат, коррелированный с экспрессией β-галактозидазы. Стрелка в L указывает на скудный воспалительный инфильтрат рядом с редкими нетрансгенными мышечными волокнами, экспрессирующими β-галактозидазу, через 42 дня после инъекции.(× 20).

Динамика экспрессии кодируемой вектором β-галактозидазы в мышцах трансгенных и нетрансгенных мышей lacZ . Пропорциональную площадь мышечных срезов, экспрессирующих кодируемую вектором β-галактозидазу, после внутримышечной инъекции AdDYSβgal определяли количественно. Показаны средние значения на каждый момент времени с их стандартными ошибками. Количество трансгенных и нетрансгенных животных указано ниже и выше стандартной шкалы ошибок соответственно.

Обширная воспалительная клеточная инфильтрация у нетрансгенных мышей, инъецированных AdDYSβgal.

Воспалительный клеточный инфильтрат наблюдался во всех нетрансгенных мышцах, инъецированных AdDYSβgal, в которых обнаруживалась экспрессия β-галактозидазы. В целом степень воспаления коррелировала с уровнем экспрессии β-галактозидазы (сравните фиг.2 D , H и L с C , G и K ). Через 14 и 28 дней после инъекции наблюдалось обширное воспаление в местах высокой экспрессии β-галактозидазы.Через 42 дня после инъекции доля площади поперечного сечения мышцы с экспрессией β-галактозидазы уменьшилась, и степень клеточного инфильтрата, обнаруженного вокруг оставшихся волокон, экспрессирующих β-галактозидазу, также уменьшилась (фиг. 2 L ). Воспаление мышц (рис.2 B , F и J ) не наблюдалось ни у каких трансгенных мышей lacZ , которым вводили эквивалентное количество AdDYSβgal, несмотря на постоянно высокий уровень экспрессии β-галактозидазы в течение исследование (рис.2 A , E и I ). Эти результаты предполагают, что иммунологический ответ, наблюдаемый в трансдуцированных вектором нетрансгенных мышцах, вызывал снижение экспрессии кодируемой вектором β-галактозидазы. Большинство инфильтрирующих клеток у нетрансгенных мышей представляли собой Т-клетки CD4 + и CD8 + , как показывает иммуноокрашивание (фиг. 4). Следовательно, вполне вероятно, что презентация антигена как MHC класса I, так и класса II опосредует иммунный ответ, наблюдаемый в нетрансгенных мышцах, трансдуцированных AdDYSβgal.Скудные макрофаги, обнаруженные с помощью антител, специфичных для макрофагов мыши, также наблюдались в нетрансгенных мышцах, трансдуцированных AdDYSβgal (фиг. 4).

Обнаружение CD4 + , CD8 + Т-клеток и макрофагов на участке экспрессии кодируемой вектором β-галактозидазы у нетрансгенных мышей. Последовательные срезы нетрансгенной мышцы мыши через 28 дней после внутримышечной инъекции AdDYSβgal. ( A ) Окрашено гематоксилином и эозином; ( B ), окрашенный X-Gal; ( C ) иммуноокрашенное моноклональным антителом против CD4; ( D ) иммуноокрашенный моноклональным антителом против CD8; ( E ), иммуноокрашенный антимакрофагальным антителом.(× 80).

Потеря экспрессии β-галактозидазы у нетрансгенных мышей только частично объясняется потерей ДНК вирусного вектора.

Наша первоначальная гипотеза предсказывала, что ДНК вирусного вектора должна элиминироваться у нетрансгенных мышей из-за иммуно-опосредованного удаления мышечных волокон, несущих вектор, экспрессирующий β-галактозидазу. Чтобы проверить эту гипотезу, мы сравнили стабильность векторной ДНК у трансгенных и нетрансгенных мышей lacZ с помощью полуколичественного ПЦР-анализа, обнаруженного с помощью саузерн-блоттинга (26).Образцы ДНК были взяты из тех же трансгенных и нетрансгенных мышц lacZ , которые использовались для тестирования экспрессии β-галактозидазы. Каждый образец ДНК амплифицировали ДНК-полимеразой Taq и двумя наборами праймеров. Один набор праймеров был специфичен для амплификации вектора AdDYSβgal, а другой набор праймеров был специфичен для гена адипсина мыши, который служил в качестве внутреннего контроля количества вводимой ДНК (100 нг, что эквивалентно приблизительно 20000 ядер). Неинъецированную мышечную ДНК мыши смешивали с известным числом копий плазмидной ДНК pDYSβgal (18) и параллельно амплифицировали, чтобы получить стандартную кривую для количественного определения векторной ДНК.Полученные продукты ПЦР анализировали с помощью саузерн-блоттинга. Используя этот метод, мы смогли обнаружить одну копию вирусной векторной ДНК на 200 ядер.

Трансгенная мышца мыши lacZ содержала в среднем 0,4 копии вектора на ядро ​​на протяжении всего исследования (рис. 5). Наблюдалась тенденция к уменьшению числа копий вектора на ядро ​​между 14 и 84 днями, но это не было значительным ( P > 0,1). Однако, несмотря на такую ​​стойкость векторной ДНК, доля площади поперечного сечения мышц, экспрессирующая кодируемую вектором β-галактозидазу, уменьшалась между 63 и 84 дневными точками времени.В отличие от наших результатов в трансдуцированной трансгенной мышце lacZ , уменьшение числа копий вектора в трансдуцированной нетрансгенной мышце было обнаружено уже через 28 дней после инъекции (с 0,4 копии на ядро ​​на 14 день до 0,1 копии на ядро ​​на 28 день). (Рис. 5). Это уменьшение числа копий вектора в трансдуцированной нетрансгенной мышце также отражалось в снижении экспрессии β-галактозидазы через 42 дня после инъекции. Промежуток времени между потерей вирусного вектора и потерей экспрессии β-галактозидазы, вероятно, отражает медленную деградацию β-галактозидазы в мышечных волокнах.Неожиданно оказалось, что векторная ДНК все еще может быть обнаружена в трансдуцированной нетрансгенной мышце при приблизительно 0,1 копии на ядро ​​через 84 дня после инъекции. Следовательно, иммунный ответ, вызванный экспрессией кодируемой вектором β-галактозидазы в нетрансгенных мышцах, не устранял всю векторную ДНК.

Стабильность ДНК вирусного вектора у трансгенных и нетрансгенных мышей lacZ после внутримышечной инъекции AdDYSβgal. Образцы тотальной мышечной ДНК, экстрагированные из трансгенных и нетрансгенных мышей lacZ с инъекцией вектора, анализировали на ДНК вирусного вектора с помощью ПЦР.Неинъецированную мышечную ДНК мыши смешивали с известным числом копий плазмиды pDYSβgal и амплифицировали в параллельных реакциях для создания стандартной кривой для количественного определения векторной ДНК. Представленные данные представляют собой результат сканирования PhosphorImager ПЦР-саузерн-блоттинга после нормализации входящей ДНК к продукту ПЦР адипсина. Средние значения числа копий вектора на ядро ​​показаны с их стандартными ошибками в каждый момент времени. Количество трансгенных и нетрансгенных животных указано над и под столбцами стандартных ошибок соответственно.Изученные здесь животные были из тех же групп, которые изучали на экспрессию кодируемого вектором белка β-галактозидазы (см. Фиг. 3).

ОБСУЖДЕНИЕ

Существовали две основные цели, определяющие развитие аденовирусных векторов для генной терапии МДД: ( i ) увеличение емкости вставки для размещения всей кДНК дистрофина и ( ii ) устранение иммунного ответа, вызванного аденовирусами первого поколения. кодируемые вектором вирусные белки.Включение полноразмерной кДНК дистрофина было достигнуто при разработке аденовирусного вектора большой емкости AdDYSβgal (18). Наши предыдущие исследования in vivo на мышах mdx продемонстрировали полноразмерную экспрессию дистрофина из вектора, которая сопровождалась восстановлением белков, ассоциированных с дистрофином, и гистологическим улучшением дистрофических мышц. Однако экспрессия вектора в мышце mdx достигла пика через 28 дней и снизилась через 42 дня после инъекции.Здесь мы выяснили, связано ли снижение экспрессии с потерей векторной ДНК и влияет ли иммунологический ответ против продукта маркерного гена на потерю экспрессии.

Устойчивая экспрессия вектора AdDYSβgal в течение по меньшей мере 84 дней наблюдалась у трансгенных мышей lacZ , толеризованных к β-галактозидазе. У мышей, толеризованных с помощью β-галактозидазы, не наблюдалось никаких доказательств опосредованного Т-клетками иммунного ответа. Напротив, контрольная нетрансгенная мышца, трансдуцированная AdDYSβgal, показала значительное снижение экспрессии β-галактозидазы уже через 42 дня после инъекции, а β-галактозидаза не была обнаружена через 84 дня после инъекции.Кроме того, обширная воспалительная клеточная инфильтрация, состоящая в основном из лимфоцитов CD4 + и CD8 + , была связана с экспрессией β-галактозидазы у нетрансгенных мышей. Эти результаты подтверждают гипотезу о том, что иммунный ответ, индуцированный чужеродным белком, β-галактозидазой, был ответственен за потерю экспрессии вирусного вектора у нетрансгенных мышей. Трипати и его коллеги также сообщили, что чужеродный трансген, экспрессируемый в мышцах из аденовирусного вектора первого поколения, был основной детерминантой, индуцирующей иммунный ответ и ограничивающей стабильность экспрессии вектора (6).

ДНК

, выделенная из нетрансгенной мышцы, инъецированной AdDYSβgal, показала снижение числа копий вектора на ядро ​​уже через 28 дней после инъекции, но оставалась на обнаруживаемом уровне в течение 84 дней. Эти результаты демонстрируют, что иммунный ответ, вызванный экспрессией кодируемой вектором β-галактозидазы, не привел к полному удалению вектора из мышцы, и предполагают, что экспрессия β-галактозидазы либо упала ниже порога обнаружения, либо была отключена в тех мышечных волокнах, где вирусный вектор ДНК сохранилась.β-Галактозидаза, экспрессируемая из AdDYSβgal, находится под контролем предраннего промотора CMV. Другие исследователи показали, что интерферон-γ, который будет продуцироваться в ходе иммунного ответа, опосредованного Т-клетками, может ингибировать промотор CMV (27). Хотя мы не измеряли продукцию цитокинов напрямую, обширная инфильтрация Т-клеток, наблюдаемая в трансдуцированных вектором нетрансгенных мышцах, свидетельствует о локальном высвобождении цитокинов. Подавление экспрессии β-галактозидазы из AdDYSβgal может позволить мышечным волокнам, несущим ДНК вирусного вектора, избежать иммунного надзора и сохранить остаточный вектор через 84 дня после инъекции.Таким образом, наблюдаемая потеря экспрессии β-галактозидазы у нетрансгенных мышей только частично объясняется потерей вирусной векторной ДНК и потенциально также отражает иммуноопосредованную репрессию промотора CMV.

У трансгенных мышей lacZ экспрессия β-галактозидазы, кодируемая вектором, все еще присутствовала через 84 дня после внутримышечной инъекции AdDYSβgal, но на более низком уровне, чем через 63 дня. Несмотря на это значительное снижение экспрессии β-галактозидазы, соответствующего значительного снижения уровней векторной ДНК не наблюдалось.Следовательно, снижение экспрессии β-галактозидазы нельзя объяснить только потерей векторной ДНК. Потеря экспрессии трансгена в мышцах от промотора CMV при отсутствии иммунного ответа наблюдалась другими. Когда аналогичный немедленный ранний промотор CMV был использован для контроля экспрессии кДНК собачьего фактора IX из рекомбинантного ретровируса, инфицированные первичные миобласты мыши и производные от них мышечные трубки секретировали фактор IX (28). Однако после трансплантации инфицированных первичных миобластов голым мышам экспрессия in vivo собачьего фактора IX увеличилась на 2–4 дня, а затем прекратилась, что позволяет предположить, что регуляция транскрипции промотора CMV различалась на in vitro и in vivo. .С другой стороны, потеря экспрессии трансгена у трансгенных мышей lacZ может отражать постепенную деградацию вирусного вектора. Поскольку большая часть аденовирусного генома дикого типа была заменена при конструировании AdDYSβgal, можно было ожидать другую нуклеосомную структуру в AdDYSβgal, которая могла бы повлиять на чувствительность векторной ДНК к эндо- и экзонуклеазам. Хотя мы продемонстрировали устойчивость векторной ДНК в отсутствие иммунного ответа на β-галактозидазу, потребуются дальнейшие исследования для определения полной целостности ДНК AdDYSβgal в мышечных волокнах.В этом отношении также будет важно сравнить экспрессию трансгена и стабильность вектора AdDYSβgal с таковыми из аденовирусных векторов предыдущего поколения, которые сохраняют больше аденовирусного генома в дополнение к рекомбинантному трансгену.

Возможно, что введение аденовирусного вектора на ранних этапах жизни может привести к иммунной толерантности к чужеродным белкам, экспрессируемым из вектора. Однако способность животных в наших экспериментах вызывать иммунный ответ на чужеродные белки отражалась обширным клеточным инфильтратом, наблюдаемым в нетрансгенной контрольной мышце, несмотря на введение вектора в возрасте 4 дней.Отсутствие клеточного иммунного ответа на AdDYSβgal в толерантной к β-галактозидазе мышце мыши свидетельствует о том, что компонентов вектора AdDYSβgal, отличных от β-галактозидазы, недостаточно для того, чтобы вызвать клеточный иммунный ответ. В частности, вирус-помощник, оставшийся в препарате вектора (приблизительно 1%), по-видимому, не вызывал клеточного иммунного ответа в трансгенной мышце lacZ , трансдуцированной вектором. Поскольку как трансгенные, так и нетрансгенные мыши lacZ экспрессируют дистрофин дикого типа в мышцах, исследования, представленные здесь, не могли определить, будет ли экспрессия векторно-кодируемого дистрофина вызывать иммунный ответ в дистрофин-дефицитных мышцах mdx или DMD.

Таким образом, аденовирусные векторы большой емкости имеют большие перспективы для доставки больших генов, таких как кДНК дистрофина, в мышцы. Мы демонстрируем, что трансгены, доставляемые аденовирусным вектором, лишенным всех вирусных генов, стабильно сохраняются в скелетных мышцах. Наши исследования ясно показывают, что оценка терапевтического потенциала AdDYSβgal потребует тестирования в мышцах с дефицитом дистрофина, которые толерантны к β-галактозидазе. В конечном счете, для проверки эффективности переноса гена дистрофина при МДД потребуется разработка новых векторов, экспрессирующих дистрофин, но не маркерный белок.

Благодарности

Мы благодарим докторов наук. Александру Ф. Р. Стюарту, Эрику П. Хоффману и Сьюзен А. Маккарти за рецензирование рукописи и доктору Саймону П. Уоткинсу и Дэвиду С. Тернеру из Центра структурной биологии изображений за помощь в фотографировании гистологических срезов. Мы благодарим Стивена Чана за помощь в анализе данных. Эта работа была поддержана грантами Ассоциации мышечной дистрофии (P.R.C.), Национальных институтов здоровья (гранты NS01611 для P.R.C. и AR36294 для M.O.) и Европейского сообщества по биотехнологиям (грант PL950228 для R.K.).

Сноски

  • ↵ электронная почта: [email protected]

  • C. Thomas Caskey, Merck & Co., Inc., Вест-Пойнт, Пенсильвания

СОКРАЩЕНИЯ

DMD,
мышечная дистрофия Дюшенна;
CMV,
цитомегаловирус;
X-Gal,
5-бром-4-хлор-3-индолил β-d-галактозид
  • Поступило 5 ноября 1996 г.
  • Принято 17 декабря 1996 г.
  • Авторские права © 1997, Национальная академия наук США

Четкая трансдукция мышечной ткани у мышей после системной доставки векторов AAVpo1

  • 1.

    Дуан Д. Системная доставка аденоассоциированных вирусных векторов. Curr Opin Virol. 2016; 21: 16–25.

    CAS PubMed PubMed Central Google ученый

  • 2.

    Muller OJ, Katus HA, Bekeredjian R.Нацеливание на сердце с помощью методов доставки генов, оптимизированных для генной терапии. Cardiovasc Res. 2007. 73: 453–62.

    Google ученый

  • 3.

    Muller OJ, Leuchs B., Pleger ST, Grimm D, Franz WM, Katus HA, et al. Улучшенный перенос сердечных генов за счет транскрипционного и трансдукционного нацеливания аденоассоциированных вирусных векторов. Cardiovasc Res. 2006; 70: 70–8.

    Google ученый

  • 4.

    Bostick B, Ghosh A, Yue Y, Long C, Duan D. Системная трансдукция AAV-9 у мышей зависит от возраста животных, но не от пути введения. Gene Ther. 2007. 14: 1605–9.

    CAS Google ученый

  • 5.

    Yue Y, Ghosh A, Long C, Bostick B, Smith BF, Kornegay JN, et al. Однократная внутривенная инъекция аденоассоциированного вируса серотипа-9 приводит к трансдукции скелетных мышц всего тела у собак. Mol Ther. 2008; 16: 1944–52.

    CAS PubMed PubMed Central Google ученый

  • 6.

    Инагаки К., Фуесс С., Сторм Т.А., Гибсон Г.А., Мактиернан К.Ф., Кей М.А. и др. Надежная системная трансдукция с помощью векторов AAV9 у мышей: эффективный глобальный перенос сердечных генов превосходит перенос AAV8. Mol Ther. 2006; 14: 45–53.

    CAS PubMed PubMed Central Google ученый

  • 7.

    Pacak CA, Mah CS, Thattaliyath BD, Conlon TJ, Lewis MA, Cloutier DE, et al.Рекомбинантный аденоассоциированный вирус серотипа 9 приводит к преимущественной сердечной трансдукции in vivo. Circ Res. 2006; 99: e3–9.

    CAS Google ученый

  • 8.

    Вандендрише Т., Торрес Л., Акоста-Санчес А., Петрус И., Ван Л., Ма Л. и др. Эффективность и безопасность аденоассоциированных вирусных векторов на основе серотипов 8 и 9 по сравнению с лентивирусными векторами для генной терапии гемофилии B. J Thromb Haemost. 2007; 5: 16–24.

    CAS Google ученый

  • 9.

    Джонс Д. Мышечная дистрофия Дюшенна ожидает генной терапии. Nat Biotechnol. 2019; 37: 335–7.

    CAS Google ученый

  • 10.

    Amoasii L, Long C, Li H, Mireault AA, Shelton JM, Sanchez-Ortiz E, et al. Однократное редактирование генома восстанавливает экспрессию дистрофина в новой мышиной модели мышечной дистрофии. Sci Transl Med. 2017; 9: eaan8081. https://doi.org/10.1126/scitranslmed.aan8081.

  • 11.

    Дуан Д. Системная генная терапия микродистрофином AAV при мышечной дистрофии Дюшенна.Mol Ther. 2018; 26: 2337–56.

    CAS PubMed PubMed Central Google ученый

  • 12.

    Чайлдерс М.К., Жубер Р., Пулар К., Моал С., Грейндж Р.В., Деринг Дж. А. и др. Генная терапия продлевает выживаемость и восстанавливает функции мышиных и собачьих моделей миотубулярной миопатии. Sci Transl Med. 2014; 6: 220ра10.

    PubMed PubMed Central Google ученый

  • 13.

    Buj-Bello A, Fougerousse F, Schwab Y, Messaddeq N, Spehner D, Pierson CR, et al.AAV-опосредованная внутримышечная доставка миотубулярина корректирует фенотип миотубулярной миопатии в целевой мышце мыши и предполагает функцию гомеостаза плазматической мембраны. Hum Mol Genet. 2008; 17: 2132–43.

    CAS PubMed PubMed Central Google ученый

  • 14.

    Элверман М., Годдард М.А., Мак Д., Снайдер Дж. М., Лоулор М. В., Менг Х и др. Долгосрочные эффекты системной генной терапии на собачьей модели миотубулярной миопатии.Мышечный нерв. 2017; 56: 943–53.

    CAS PubMed PubMed Central Google ученый

  • 15.

    Manno CS, Pierce GF, Arruda VR, Glader B, Ragni M, Rasko JJ, et al. Успешная трансдукция печени при гемофилии AAV-фактором IX и ограничения, налагаемые иммунным ответом хозяина. Nat Med. 2006; 12: 342–7.

    CAS Google ученый

  • 16.

    Mingozzi F, High KA.Иммунные ответы на AAV в клинических испытаниях. Curr Gene Ther. 2007; 7: 316–24.

    CAS Google ученый

  • 17.

    Mingozzi F, High KA. Терапевтический перенос генов in vivo при генетических заболеваниях с использованием AAV: прогресс и проблемы. Nat Rev Genet. 2011; 12: 341–55.

    CAS Google ученый

  • 18.

    Mingozzi F, Meulenberg JJ, Hui DJ, Basner-Tschakarjan E, Hasbrouck NC, Edmonson SA, et al.Опосредованный AAV-1 перенос гена в скелетные мышцы у человека приводит к дозозависимой активации капсид-специфичных Т-клеток. Кровь. 2009. 114: 2077–86.

    CAS PubMed PubMed Central Google ученый

  • 19.

    Pien GC, Basner-Tschakarjan E, Hui DJ, Mentlik AN, Finn JD, Hasbrouck NC, et al. Презентация капсидного антигена сигнализирует о разрушении гепатоцитов человека после трансдукции аденоассоциированными вирусными векторами. J Clin исследования.2009; 119: 1688–95.

    CAS Google ученый

  • 20.

    Martino AT, Basner-Tschakarjan E, Markusic DM, Finn JD, Hinderer C, Zhou S, et al. Сконструированный вектор AAV сводит к минимуму нацеливание in vivo на трансдуцированные гепатоциты капсид-специфическими CD8 + Т-клетками. Кровь. 2013; 121: 2224–33.

    CAS PubMed PubMed Central Google ученый

  • 21.

    Сан Б., Чжан Х., Франко Л. М., Браун Т., Бёрд А., Шнайдер А. и др.Коррекция болезни накопления гликогена типа II с помощью вектора аденоассоциированного вируса, содержащего мышечно-специфический промотор. Mol Ther. 2005; 11: 889–98.

    CAS Google ученый

  • 22.

    Sun B, Zhang H, Franco LM, Young SP, Schneider A, Bird A и др. Эффективность 8-псевдотипированного вектора аденоассоциированного вируса при болезни накопления гликогена II типа. Mol Ther. 2005; 11: 57–65.

    CAS Google ученый

  • 23.

    Mah C, Pacak CA, Cresawn KO, Deruisseau LR, Germain S, Lewis MA и др. Физиологическая коррекция болезни Помпе путем системной доставки векторов серотипа 1 аденоассоциированного вируса. Mol Ther. 2007; 15: 501–7.

    CAS Google ученый

  • 24.

    Хан СО, Ли С., Брукс Э.Д., Масат Э., Леборн С., Банугария С. и др. Повышенная эффективность генной терапии при болезни Помпе с использованием блокады корецепторов. Hum Gene Ther. 2015; 26: 26–35.

    CAS Google ученый

  • 25.

    Белло А., Тран К., Чанд А., Дориа М., Аллокка М., Хильдингер М. и др. Выделение и оценка новых последовательностей аденоассоциированного вируса из тканей свиньи. Gene Ther. 2009; 16: 1320–8.

    CAS Google ученый

  • 26.

    Белло А., Чанд А., Авилес Дж., Соул Г., Ауриккио А., Кобингер Г.П. Новые аденоассоциированные вирусы, происходящие из тканей свиней, трансдуцируют большинство основных органов мышей. Научный отчет 2014; 4: 6644.

    CAS PubMed PubMed Central Google ученый

  • 27.

    Пуппо А., Белло А., Манфреди А., Чези Г., Маррокко Е., Делла Корте М. и др. Рекомбинантные векторы на основе аденоассоциированных вирусных серотипов свиней трансдуцируют сетчатку мышей и свиней. PLoS One. 2013; 8: e59025.

    CAS PubMed PubMed Central Google ученый

  • 28.

    Zincarelli C, Soltys S, Rengo G, Rabinowitz JE. Анализ экспрессии генов, опосредованных серотипами 1-9 AAV, и тропизма у мышей после системной инъекции. Mol Ther.2008; 16: 1073–80.

    CAS Google ученый

  • 29.

    Li X, Eastman EM, Schwartz RJ, Draghia-Akli R. Синтетические мышечные промоторы: активность, превышающая естественные регуляторные последовательности. Nat Biotechnol. 1999; 17: 241–5.

    CAS Google ученый

  • 30.

    Rincon MY, Sarcar S, Danso-Abeam D, Keyaerts M, Matrai J, Samara-Kuko E, et al. Полногеномный компьютерный анализ выявляет специфичные для кардиомиоцитов транскрипционные цис-регуляторные мотивы, которые делают возможной эффективную сердечную генную терапию.Mol Ther. 2015; 23: 43–52.

    CAS Google ученый

  • 31.

    Sarcar S, Tulalamba W, Rincon MY, Tipanee J, Pham HQ, Evens H, et al. Мышечно-направленная генная терапия нового поколения с помощью дизайна in silico. Nat Commun. 2019; 10: 492.

    CAS PubMed PubMed Central Google ученый

  • 32.

    Мисбах В., Мейер К., Коппенс М., Кампманн П., Кламрот Р., Шутгенс Р. и др.Генная терапия аденоассоциированным вирусным вектором 5-человеческий фактор IX у взрослых с гемофилией B. Кровь. 2018; 131: 1022–31.

    CAS PubMed PubMed Central Google ученый

  • 33.

    Mingozzi F, Maus MV, Hui DJ, Sabatino DE, Murphy SL, Rasko JE, et al. CD8 (+) Т-клеточные ответы на капсид аденоассоциированного вируса у людей. Nat Med. 2007; 13: 419–22.

    CAS Google ученый

  • 34.

    Джордж Л.А., Салливан С.К., Гермаш А., Раско Дж.Э.Дж., Самельсон-Джонс Б.Дж., Дюкор Дж. И др. Генная терапия гемофилии B с вариантом фактора IX высокой специфической активности. N Engl J Med. 2017; 377: 2215–27.

    CAS PubMed PubMed Central Google ученый

  • 35.

    Mendell JR, Al-Zaidy S, Shell R, Arnold WD, Rodino-Klapac LR, Prior TW, et al. Однодозная генно-заместительная терапия при мышечной атрофии позвоночника. N Engl J Med. 2017; 377: 1713–22.

    CAS Google ученый

  • 36.

    Nathwani AC, Tuddenham EG, Rangarajan S, Rosales C, McIntosh J, Linch DC, et al. Опосредованный вектором аденовируса перенос генов при гемофилии B. N Engl J Med. 2011; 365: 2357–65.

    CAS PubMed PubMed Central Google ученый

  • 37.

    Гримм Д., Золотухин С. E pluribus unum: 50 лет исследований, миллионы вирусов и одно целевое ускорение эволюции AAV.Mol Ther. 2015; 23: 1819–31.

    CAS PubMed PubMed Central Google ученый

  • 38.

    Вайнманн Дж., Гримм Д. Векторы AAV нового поколения для клинического использования: постоянно ускоряющаяся гонка. Гены вирусов. 2017; 53: 707–13.

    CAS Google ученый

  • 39.

    Гримм Д., Ли Дж. С., Ван Л., Десаи Т., Акаче Б., Сторм Т.А. и др. Эволюция вектора генной терапии in vitro и in vivo посредством многовидового скрещивания и перенацеливания аденоассоциированных вирусов.J Virol. 2008; 82: 5887–911.

    CAS PubMed PubMed Central Google ученый

  • 40.

    Херрманн А.К., Бендер С., Кинле Э., Гросс С., Эль Андари Дж., Ботта Дж. И др. Надежный и всеобъемлющий конвейер для перетасовки аденоассоциированных вирусов. ACS Synth Biol. 2019; 8: 194–206.

    CAS Google ученый

  • 41.

    Zinn E, Pacouret S, Khaychuk V, Turunen HT, Carvalho LS, Andres-Mateos E, et al.Реконструкция вирусной эволюционной линии in silico дает мощный вектор генной терапии. Cell Rep. 2015; 12: 1056–68.

    CAS PubMed PubMed Central Google ученый

  • 42.

    Fakhiri J, Schneider MA, Puschhof J, Stanifer M, Schildgen V, Holderbach S, et al. Новые химерные векторы для генной терапии на основе аденоассоциированного вируса и четырех различных бокавирусов млекопитающих. Mol Ther Methods Clin Dev. 2019; 12: 202–22.

    CAS PubMed PubMed Central Google ученый

  • Направленное движение с мышечными силами

    Ваше тело имеет конечное количество мышц, но оно может генерировать движение в бесконечном количестве направлений.Этот шахматист может подвигать руку к любой шахматной фигуре и перемещать ее в любом направлении на доске. Комбинация сил различных мышц в сочетании с костями и соединительной тканью может объединяться для создания силы в любом направлении. Силы различных мышц и костей могут быть объединены путем сложения векторов для создания результирующей силы практически в любом желаемом направлении. Это достигается за счет сокращения мышц под сознательным контролем.

    Сложение сил в виде векторов можно визуализировать геометрически.Начиная с пар сил, рассмотрите сложение двух сил под прямым углом. Физический эффект приложения силы 30 Н и силы 40 Н под прямым углом будет идентичен приложению одной силы 50 Н в направлении гипотенузы треугольника, образованного силами 30 Н и 40 Н.

    Векторная сумма любых двух сил может быть получена геометрически путем измерения диагонали параллелограмма, образованного векторами. Их также можно определить с помощью тригонометрии путем вычисления компонентов векторов и их объединения в прямоугольный треугольник.Затем приведенное выше соотношение Пифагора можно использовать для нахождения результата. Чтобы подтвердить числа справа, попробуйте вычислить сложение векторов.

    Показан набор из пяти сил, действующих на один и тот же объект. Результат должен быть найден до того, как можно будет сделать какое-либо предсказание его движения. Этот результат можно найти, нарисовав векторы от хвоста к голове в любом порядке , как показано слева.

    Хотя графический метод сложения векторов может использоваться для любого количества векторов, наиболее практичный метод сложения векторов включает вычисление компонентов всех векторов.Для векторов в плоскости xy компоненты x и y могут быть объединены, чтобы получить компоненты x и y результирующего. Его можно преобразовать в полярную форму, чтобы получить величину и направление результирующей силы.

    В такой мышечной системе, как плечевая, несколько мышц проявляют силы, которые объединяются как векторы, чтобы создать результирующую силу для направленного движения.

    Индекс

    Законы Ньютона

    Стандартные проблемы механики

    Новый вирусный вектор, используемый в MD, может повысить эффективность генной терапии

    Новый вирусный вектор, который лучше обычных векторов — инструменты, предназначенные для доставки генетического материала в клетки — на По мнению исследователей, нацеливание на мышечные клетки может оказаться полезным при разработке более эффективной генной терапии мышечной дистрофии (МД).

    Фактически, этот новый вектор «более чем в 10 раз эффективнее воздействует на мышцы, чем те, которые в настоящее время используются в клинических испытаниях», — заявили ученые в новостях.

    Исследователи описали новый вектор в журнале Cell в исследовании под названием «Направленная эволюция семейства вариантов капсида AAV, обеспечивающая эффективную доставку генов, направленную на мышцы, у разных видов».

    Общая цель генной терапии — исправить генетический дефект, вызывающий заболевание — например, доставить немутантную версию гена к пораженным клеткам.Обычно это делается с использованием вирусного вектора, называемого аденоассоциированным вирусом, или AAV, которым можно манипулировать в лабораториях и который не вызывает заболеваний у людей.

    Рекомендуемая литература

    Основная идея состоит в том, что теперь безвредный вирус может доставить сконструированную генетическую нагрузку к клеткам организма посредством процесса, называемого трансдукцией. Этот процесс похож на то, как вирусы обычно заражают клетки.

    Разработка генной терапии на основе AAV для мышечной дистрофии и других мышечных заболеваний была сложной, потому что для того, чтобы такие методы лечения были эффективными, они должны целенаправленно воздействовать на мышечные клетки.Часто вирусный вектор попадает в другие ткани, особенно в печень, что может вызвать серьезные проблемы с безопасностью. Кроме того, по мнению исследователей, обычно необходимы большие дозы вируса, несущего ген, чтобы достичь мышц по всему телу. Такие высокие дозы могут иметь нежелательные побочные эффекты.

    «Мы знаем, что если вы получите достаточное количество [генной терапии] в ткани-мишени, это будет эффективно. Все дело в доставке безопасной дозы вируса », — сказал Шариф Табебордбар, доктор философии, исследователь из Института Броуда Массачусетского технологического института и Гарварда в Массачусетсе и ведущий автор исследования.

    Табебордбар работает в этой области в течение десяти лет, вдохновленный своим отцом, которому был поставлен диагноз редкого генетического заболевания мышц.

    Профессор биотехнологии и его коллеги решили разработать вектор AAV, который мог бы более эффективно воздействовать на мышечную ткань. Для этого они разработали систему под названием «Направленная эволюция капсидов AAV с использованием экспрессии трансгенной РНК in vivo», или «DELIVER».

    Проще говоря, система включает в себя начало с установленного вектора под названием AAV9, а затем создание множества различных вирусных капсидов или оболочек с небольшими случайными различиями в их генетическом коде.Затем эти векторы вводят мышам, и исследователи изучают мышечную ткань, чтобы найти векторы, которые могут наиболее эффективно доставлять свой генетический груз.

    В частности, исследователи искали экспрессию вирусных трансгенов в мышечной ткани — другими словами, степень «считывания» вирусного генетического материала клетками. Затем наиболее успешные вирусные капсиды отбирали для дальнейшего отбора и анализа.

    «Наш метод уникален, потому что мы проверили широкий спектр капсидов и использовали очень строгие критерии отбора», — сказал Табебордбар.«Мы хотели найти капсиды, которые могли бы не только физически проникать в клетку, но также проходить различные стадии трансдукции и экспрессировать свои трансгены».

    Команда выбрала один капсид AAV, который они назвали MyoAAV 1A, для дальнейшего тестирования. Это показало, что вектор был способен эффективно доставлять генетическую информацию к мышечным клеткам мышей, в то время как доставка в печень была заметно снижена, и никаких повреждений печени обнаружено не было.

    Дальнейшие исследования на мышиной модели мышечной дистрофии Дюшенна (DMD), наиболее распространенного типа MD, дополнительно подтвердили, что MyoAAV 1A способен эффективно доставлять генетический материал к мышечным клеткам.

    Обработанные животные также показали большую силу. В модели миотубулярной миопатии, сцепленной с Х-хромосомой, MyoAAV 1A привел к заметному улучшению мышечной функции, веса и выживаемости при вирусной дозе до 50 раз ниже, чем та, которая в настоящее время используется в клинических испытаниях (NCT03199469), заявили исследователи.

    Примечательно, что MyoAAV 1A превзошел исходный вектор AAV9, который используется в генной терапии, которая в настоящее время проходит клинические испытания.

    Путем дополнительных структурных анализов и раундов отбора исследователи создали еще один вектор — MyoAAV 2A, который оказался еще более эффективным при трансдукции мышечных клеток.MyoAAV 2A превзошел как AAV9, так и другой вектор, тестируемый в клинических испытаниях, AAVrh74, на мышиной модели МДД.

    Дальнейшие эксперименты показали, что платформу DELIVER можно модифицировать для генерации вирусов, способных воздействовать на мышечные клетки нечеловеческих приматов (макак cynomolgus). Они также выявили структурные особенности, которые, по-видимому, связаны со способностью вируса так эффективно проникать в мышечные клетки.

    Рекомендуемая литература

    Хотя в этом исследовании исследователи специально сосредоточились на мышечных клетках, они отметили, что платформа DELIVER представляет собой «комплексную стратегию для разработки и выбора эффективных вариантов капсида AAV для эффективной доставки генов в любую ткань и / или тип клеток, представляющий интерес.”

    «Мы разработали семейство капсидов, нашли механизм, с помощью которого они доставляют гены, показали, что этот механизм сохраняется у разных видов, и показали, что мы можем обеспечить терапевтический эффект на животных моделях с чрезвычайно низкой дозой вируса, — сказал Табебордбар.

    «Теперь мы очень взволнованы тем, как это можно использовать для обеспечения эффективной разработки лекарств для пациентов», — сказал он.

    Появление генной терапии в последние годы открыло новые возможности лечения людей с MD и другими мышечными заболеваниями.Табебордбар сказал, что у его отца начались проблемы с ходьбой, когда исследователь был подростком, и в конечном итоге он стал прикованным к инвалидному креслу.

    «Я наблюдал, как моему отцу с каждым днем ​​становится все хуже и хуже. Делать что-то вместе в семье было огромной проблемой — генетические заболевания ложатся тяжелым бременем не только на пациентов, но и на семьи. Я подумал: это очень несправедливо по отношению к пациентам, и должен быть способ исправить это. Это было моей мотивацией в течение тех 10 лет, что я работал в области генной терапии », — сказал он.

    Мышцы Векторный клипарт в AI, SVG, EPS, PSD, PNG

    Набор иконок для фитнеса. Значки включают упражнения, поднятие тяжестей, достижение целей в фитнесе, оборудование для фитнеса, бег, здоровый образ жизни, тренировки, езда на велосипеде, плавание и другие формы упражнений.

    Значок мышечной руки. Знак двуглавой мышцы. Концепция сильной власти. Векторные иллюстрации, изолированные на белом фоне

    Иллюстрация стиля силуэта супергероя, стоящего с эффектом солнечных лучей на заднем плане.Легко редактировать. Для вашей копии доступно большое пространство.

    20 иконок линии фитнеса и тренировки.

    Набор иконок Arm. Коллекция высококачественных логотипов с черным контуром для дизайна веб-сайтов и мобильных приложений. Векторная иллюстрация на белом фоне.

    Векторная иллюстрация блестящего красного сердца с мускулистыми руками.

    Анатомия локтевого сустава, изолированные на белом фотореалистичные векторные иллюстрации

    Многие руки работают вместе, чтобы поднимать тяжести.

    Типы файлов: ai, eps, большой jpg (3000×3000)

    Значок вектора сильного человека вверх

    Мышцы лица и шеи женщины, половина мышц лица и половина кожи, каждая мышца с именем на ней, подробная анатомия, яркая, выделенная на белом фоне

    Женщина играет с гранжевой текстурой

    Бодибилдер мышцы векторные иллюстрации.Здоровые и мускулистые символы частей тела фитнеса

    Иконка для различного использования Легко изменить размер. Все объекты наслоены. Векторный файл EPS и изображение jpeg full HD.

    20 Outline Style — Черная линия — Pixel Perfect icons / Набор для фитнеса и спорта # 97 Иконки выполнены в квадрате 48x48pх, обводка контура 2px. Первый ряд значков контура содержит: Бутылка с водой, Знак расстояния, Плавание, Спортивная обувь, Мускулистое телосложение; Вторая строка содержит: Ходьба, секундомер, здоровое питание, значок гантели, измерение талии; Третья строка содержит: Весы, Бегущий человек, Рулетка, Кардионагрузка, Растяжка; Четвертый ряд содержит: Велоспорт, бассейн, поза лотоса (йога), сон, яблоко — фрукты.Полная коллекция Primico — https://www.istockphoto.com/collaboration/boards/NQPVdXl6m0W6Zy5mWYkSyw

    Девичьи эмоции. Молодая девушка позирует в сильной позе, показывая бицепс. Плоский стиль. Мультфильм.

    Персонажи Blue Little Guy в полный рост, векторная графика. Копирование пространства. Маленький человек убегает от сильной руки с бицепсами.

    Набор векторных силуэтов культуристов. Позируют мускулистые мужчины и женщины

    Поднятие тяжестей для мальчиков

    Бицепс изолированных Векторный Icon.Иллюстрация мышцы бицепса Emoji Icon Stock illustration

    Иллюстрация стиля силуэта команды женщин-супергероев на фоне горизонта города

    Простые векторные иконки. Ясный и резкий. Легко изменить размер. Нет эффекта прозрачности. EPS10 файл. Включено нормальное и разрешенное состояние.

    синдром грушевидной мышцы 3d медицинские векторные иллюстрации на белом фоне eps 10

    Просмотреть все:

    Векторная иллюстрация человеческих мышц с упором на руку и бицепс.

    Векторный набор иконок руки. Различные кулачные знаки.

    Набор синих и оранжевых этикеток, знаков и символов для тренажерного зала и фитнеса со спортивными силуэтами мужчин и женщин

    Все изображения размещены на отдельных слоях. При необходимости их можно удалить или изменить. Использовались некоторые градиенты. Никаких прозрачных пленок.

    Поп-арт в стиле комиксов супер героиня со сжатым кулаком женщина-супергерой векторная иллюстрация

    Векторная иллюстрация силуэта женщины-супергероя с закатом позади.

    Строение скелетных мышц. веретеновидная мышца. Сухожилие. Инфографика. Векторная иллюстрация на изолированном фоне

    Нарисованный от руки векторный рисунок мощной мультяшной батареи. Черно-белый набросок на прозрачном фоне (.eps-файл). Включены файлы EPS (v10) и Hi-Res JPG.

    Векторная иллюстрация фитнес-тренировки.

    Женский женский спорт, танец, борцовский силуэт вектор 25 набор

    Культурист по сгибанию и поднятию тяжестей http://www.twodozendesign.info/i/1.png

    Векторная иллюстрация иллюстрации мышцы головы человека

    Сердце с сильными руками

    базовая анатомия в разобранном виде — изометрия

    Векторная иллюстрация: человеческие органы

    Сильная женщина, стоящая икона. На этой векторной иллюстрации, не требующей лицензионных отчислений, основной значок изображен черным цветом внутри белого квадрата. Альтернативные варианты цвета: синий, зеленый, желтый и красный — находятся справа от значка и расположены в вертикальном столбце.

    Четыре женщины разных национальностей и культур стоят вместе. Женская дружба, союз феминисток или сестринство. Концепция женского движения за расширение прав и возможностей.

    Вид на мышцы человека со спины. Вы можете легко изменить цвет каждой мышцы.

    Жест рукой в ​​виде непрерывной линии. Эскиз черной линии знака власти на белом фоне. Векторная иллюстрация

    Вектор фигурки, поднимающей гантели, значок

    Согнутая мышца руки в оттенках серого.Векторная иллюстрация.

    Бодибилдер мышцы сгибает руку векторные иллюстрации

    25 плоских иконок для фитнеса и тренировок.

    Трицепс surae голеностопного сустава 3d медицинские векторные иллюстрации eps 10

    Графические иллюстрации силуэта фона межрасовой пары, тренирующейся или бегающей трусцой. Масштабируйте до любого размера. Ознакомьтесь с моим световым коробом «Фитнес, упражнения и бег», чтобы узнать больше.

    Иллюстрация в стиле комиксов, на которой мужчина рвет рубашку и превращается в супергероя.Нанесите свой логотип или текст на грудь.

    Шаблон логотипа силуэт бегущего человека

    векторная иллюстрация старшего мужчины, поднимающего штангу

    Плоский цветной силуэт пары супергероев на крыше здания на фоне линии горизонта города. Широкое пространство для копирования, доступное для вашего текста.

    Шаблон символа культуриста фитнес-зала в векторе, с характером мускулистого человека или талисманом

    Подъем штанги для мужчин

    Детский фитнес и беговая концепция.EPS 10 файл. Эффекты прозрачности, используемые для перекрывающихся элементов.

    Векторная иллюстрация — Труд жестикулирует пальцами вверх.

    Человеческое тело Иллюстрация

    Это иллюстрация шершня в боевой стойке. Все однотонные цвета, БЕЗ ГРАДИЕНТОВ. Легко отредактировать до одного цвета. Также предусмотрены ЧЕРНЫЙ и БЕЛЫЙ. Файл предоставляется в формате Illustrator 8 EPS и в формате jpg с высоким разрешением 300 точек на дюйм.

    Значок Силы воли на белом фоне

    Этот агрессивный медведь прыгает через медведя.

    Сильный мужчина.

    Набор иконок линии человеческих органов, изолированные на белом. Векторная иллюстрация

    Векторные иллюстрации в стиле ретро женского супергероя, стоящего на скале ночью. Для вашего текста доступно большое пространство.

    Векторная иллюстрация анатомии медицинской бицепса

    Кулаки черно-белые.

    Векторная иллюстрация, свирепый медведь-спортсмен позирует, показывая большие бицепсы

    Большой мускулистый супергерой со знаком вопроса на груди в серых, красных и золотых костюмах.Посмотрите других моих персонажей супергероев:

    Семья, Сердце, Человек

    детский, мужской и женский силуэт, изолированные на белом фоне. Векторная иллюстрация плоский. ребенок, мужчина и женщина.

    Этот талисман-бык отлично подходит для любого командного спорта или талисмана. Он также поставляется с черно-белой версией.

    Мышца руки. Эмодзи сильного бицепса. Смайлик силы в руке. Икона силы протеина для человека. Согните мышцу руки. Упражнения в тренажерном зале для здоровья.Логотип фитнеса, тренировки, культуриста, спорта. Вектор.

    Силуэты баскетболистов http://www.twodozendesign.info/i/1.png

    Векторная иллюстрация. Мышечные ткани. Каждое волокно скелетных мышц имеет множество пучков миофиламентов. Каждый пучок называется миофибриллой. Это то, что придает мышцам поперечно-полосатый вид. Сократительные единицы клеток называются саркомерами.

    Супергерой SuperMom в розовом.

    Иллюстрация супергероя, поднимающего большую скалу, в стиле комиксов

    Векторная иллюстрация в стиле силуэта парящего в воздухе супергероя, выделенная цветом, поэтому ее легко взять и отредактировать.

    Векторная иллюстрация — Боль в коленях.

    Стилизованный атлет с гантелью. Легко изменить цвет. Прикреплен файл CorelDRAW 10.

    Гравировка, изображающая широкоугольную ствольную коробку для американского футбола с отличным уловом

    Мужское человеческое тело — карта мышц, квадрицепс. Векторная иллюстрация — EPS10.

    Вектор анатомии мозга

    Это векторный файл первого дня Оли со своим личным тренером … О, Боже!

    Мотивационная цитата «Встретимся в баре».Концепция элемента дизайна тренажерного зала и тренировки. Творческий пользовательский векторный спортивный знак на гранж-фон

    Иллюстрация в стиле силуэта супергероя, который останавливает гигантский рок, катящийся к земле

    Медицинская реабилитационная физиотерапия Stong Heart. Иконки медицины и реабилитации заполняют основной объект и образуют бесшовный узор. Отдельные значки различаются оттенком красного цвета и шкалой. Они аккуратно сложены вместе и полностью заполняют очертания основной формы.Значки включают такие значки медицинской реабилитационной физиотерапии, как медицинские принадлежности, аптечку, изображения людей и терапевтов и многие другие значки.

    Креативность, Воображение, интеллект, Концепция дизайна мозга

    Бизнесмен, тренажерный зал, оздоровительный клуб, валюта, мускулистое телосложение

    Проиллюстрированы различные участки. Все белые штрихи / формы вырезаны из значков и объединены, позволяя просвечивать фон.

    ✅ анатомия мышц спины бесплатно векторные eps, cdr, ai, svg векторная иллюстрация графика

    Тело человека, мышцы

    Анатомия мужской мышечной системы, руководство по упражнениям и мышцам.Человеческое мышечное векторное искусство, вид спереди, вид сзади. Векторная иллюстрация

    Тело человека, мышцы

    Боль в спине

    Тело, мускулистая анатомия человека,

    Анатомия большой мышцы поясничной мышцы 3d медицинские векторные иллюстрации на белом фоне

    Анатомия мышц подколенного сухожилия 3d медицинские векторные иллюстрации на белом фоне

    Полигональная анатомия мужской мышечной системы, руководство по упражнениям и мышцам.Человеческое мышечное векторное искусство, вид спереди, вид сзади. Векторная иллюстрация

    Musculus triceps brachii 3d медицинские векторные иллюстрации на белом фоне, человеческая рука сзади

    Типы травм подколенного сухожилия 3d медицинские векторные иллюстрации на белом фоне

    Грушевидная мышца 3d медицинские векторные иллюстрации на белом фоне

    Мышцы спины ног 3d медицинские векторные иллюстрации на белом фоне

    Анатомия мышц человека с текстом

    Векторные иллюстрации шаржа мышечной системы человека для детей

    Руководство по анатомии.Мужской скелет и мышечная система с пояснениями. Вид спереди и сзади.

    Боль в пояснице

    Soleus muscle. Триггерные точки и отраженная боль в ногах. Миофасциальный релиз.

    Хирургия косоглазия. Рецессия глазной мышцы. Анатомия экстраокулярных мышц. хирург изменяет место прикрепления мышцы, отрезая мышцу от поверхности глаза и снова прикрепляя ее к глазному яблоку, подальше от передней части глаза.

    Ручной обращается эскиз мужской мышцы

    Анатомия женской мышечной системы, упражнения и мышцы. Женщины мышцы вектор искусства, вид сзади.

    Исследование мышц, ручная работа, иллюстрация

    Полигональная анатомия женской мышечной системы, упражнения и мышцы. Женщины мышцы вектор искусства, вид сзади.

    Кости человеческие разные

    Человек с болевыми точками

    Полигональная анатомия мужской мышечной системы, руководство по упражнениям и мышцам.Искусство вектора человеческих мышц, вид сзади.

    Человеческая спина, медицинские символы позвоночника

    Хиропрактика, массаж, боли в спине и остеопатия icon

    Анатомия женской мышечной системы, упражнения и мышцы. Женщины мышцы вектор искусства, вид спереди и сзади.

    Анатомия мужской мышечной системы, руководство по упражнениям и мышцам. Человеческое мышечное векторное искусство, вид спереди, вид сзади.Векторная иллюстрация

    Мужское и женское тело

    Иконы хиропрактики, массажа, боли в спине и остеопатии

    Векторная иллюстрация анатомии тела и мышц

    Выпадение межпозвоночного диска крупным планом.

    Боль в спине из-за неправильной позы при вождении

    Руководство по анатомии.Мужской скелет и мышечная система с пояснениями. Вид спереди и сзади.

    Анатомия детской мышечной системы, руководство по упражнениям и мышцам. Искусство вектора мышц ребенка, вид спереди и сзади.

    Ишиас — это заболевание, характеризующееся болью, идущей вниз по ноге от поясницы. Графический вектор информации здравоохранения.

    Хиропрактика, массаж, боли в спине и остеопатия icon

    Диаграмма мышц женского тела Имена

    Таблица групп мышц

    Мышцы

    Эскиз мужской

    Набор иконок частей мужского тела

    Боль в спине человека, логотип на белом.

    Врач осматривает пациента с болями в спине. Вектор.

    Иконы хиропрактики, массажа, боли в спине и остеопатии

    Анатомия мужской мышечной системы, руководство по упражнениям и мышцам.

    Синдром грушевидной мышцы 3d медицинские векторные иллюстрации на белом фоне

    Схема мышц мужского тела Имена

    Цветная таблица групп мышц

    Диаграмма мышц Описание Мускулистое тело Женщина

    Диаграмма мышц, немецкий текст, мужское тело

    Анатомия детской мышечной системы, руководство по упражнениям и мышцам.Искусство вектора мышц ребенка, вид спереди и сзади.

    Спортивный мужской спереди и сзади

    Положение для сна для позвоночника

    Таблица мышц женского тела Цветные мышцы черный

    Человеческая спина, медицинские символы позвоночника

    Диаграмма мышц частей мужского тела на черном фоне

    Полигональная анатомия женской мышечной системы, упражнения и мышцы.Женщины мышцы вектор искусства, вид сзади.

    Диагностика и лечение болезней позвоночника

    Человек, анатомия, мышцы, спина, спорт, фитнес, медицина, вектор

    Цветная таблица женского тела мышечных групп

    Плоский логотип остеопатия

    Торс. Спортивная (ый) силуэты мужчин, векторные символы.

    Набросок мужской анатомии

    Мышечная система человека, анатомия, вид сзади и спереди,

    Анатомия мужской мышечной системы, руководство по упражнениям и мышцам.

    Символ позвоночника человека с крестом

    Логотип диагностики позвоночника со знаком боли

    Векторное изображение позвоночника в 2D, скелетно-мышечное с закругленным прямоугольником на белом фоне

    Плакат «Системы органов человеческого тела»

    Символ позвоночника человека с крестом

    Иконы хиропрактики, массажа, боли в спине и остеопатии

    Дизайн для лечения позвоночника

    Инфографика человеческого тела

    Длиннейшая мышца 3d медицинские векторные иллюстрации на белом фоне

    Боль в позвоночнике байкера

    Комплект остеопатии с логотипом

    Плакат «Системы органов человеческого тела»

    Диаграмма мышц женских частей тела на черном фоне

    Таблица групп мышц для женщин

    Иконы хиропрактики, массажа, боли в спине и остеопатии

    Анатомическое сравнение мужских и женских мышц

    Иконы хиропрактики, массажа, боли в спине и остеопатии

    Мужчина и женщина, лицо и профиль тела

    Значок боли в спине веб-значок

    Гравюра старинной мускулярной системы

    Мышцы Таблица немецких имен Мускулистое мужское тело

    Красивая графическая информация о тренировке брюшного пресса для спины, состоящая из тяги вниз узким широчайшим, подтягивания хватом над головой вверх, тяги на блоке захвата над головой, тяги гантелей в наклоне.

    Боль в спине у мужчин, медицина и здоровье

    Иконы хиропрактики, массажа, боли в спине и остеопатии

    Длиннейшая мышца 3d медицинские векторные иллюстрации на белом фоне

    Символ позвоночника человека с крестом

    Анатомия человека, боль

    Таблица мышц мужского тела Цветные мышцы

    Таблица немецких имён групп мышц

    Кости и связки тыльной стороны кисти

    Боль в спине у мужчин

    Большой набор людей, делающих упражнения в спортзале

    Диаграмма медицинской векторной иллюстрации поясничной мышцы

    Трансдукция скелетных мышц с помощью общих репортерных генов может способствовать дегенерации и воспалению мышечных волокон

    Abstract

    Рекомбинантные аденоассоциированные вирусные векторы (rAAV-векторы) являются многообещающими инструментами для доставки трансгенов в скелетные мышцы с целью изучения механизмов, контролирующих фенотип мышц, и для облегчения заболеваний, которые нарушают гомеостаз мышц.Во многих исследованиях использовались векторы rAAV, несущие репортерные гены, кодирующие β-галактозидазу (β-gal), плацентарную щелочную фосфатазу человека (hPLAP) и зеленый флуоресцентный белок (GFP) в качестве экспериментального контроля при изучении эффектов манипулирования другими генами. Однако неясно, в какой степени эти репортерные гены могут влиять на передачу сигналов и сигнатуры экспрессии генов в скелетных мышцах, что может затруднить интерпретацию результатов, полученных в экспериментально обработанных мышцах. Здесь мы сообщаем о сильном провоспалительном эффекте экспрессии репортерных генов в скелетных мышцах.В частности, мы показываем, что введение векторов rAAV6: hPLAP в мышцы задних конечностей мышей связано с зависимым от дозы и времени рекрутингом макрофагов и повреждением скелетных мышц. Дозозависимая экспрессия hPLAP также приводила к заметной активности установленной провоспалительной передачи сигналов IL-6 / Stat3, TNFα, IKKβ и JNK в лизатах, полученных из гомогенизированных мышц. Эти эффекты не зависели от типа промотора, поскольку кассеты экспрессии, содержащие hPLAP под контролем конститутивных промоторов CMV и мышечно-специфичных CK6, вызывали клеточные ответы при подборе дозы вектора.Важно отметить, что введение векторов rAAV6: GFP не вызывало повреждения или воспаления мышц, за исключением самых высоких доз, которые мы исследовали, а введение вектора, не содержащего трансген (rAAV6: MCS), не вызывало повреждений или воспаления ни в одной из испытанных доз. демонстрируя, что экспрессирующие GFP или нулевые трансгены векторы могут быть более подходящими в качестве экспериментальных контролей. Исследования подчеркивают важность учета потенциальных эффектов репортерных генов при разработке экспериментов, которые исследуют манипуляции с генами in vivo .

    Образец цитирования: Winbanks CE, Beyer C, Qian H, Gregorevic P (2012) Трансдукция скелетных мышц с помощью общих репортерных генов может способствовать дегенерации и воспалению мышечных волокон. PLoS ONE 7 (12): e51627. https://doi.org/10.1371/journal.pone.0051627

    Редактор: Ацуши Асакура, Медицинская школа Университета Миннесоты, Соединенные Штаты Америки

    Поступила: 10.08.2012; Принято к печати: 5 ноября 2012 г .; Опубликовано: 12 декабря 2012 г.

    Авторские права: © 2012 Winbanks et al.Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

    Финансирование: Эта работа была поддержана при финансовой поддержке Национального совета здравоохранения и медицинских исследований Австралии (гранты № 526648 и 586649, http://www.nhmrc.gov.au/) и Ассоциации мышечной дистрофии, США. Штаты Америки (грант № 69684, http: // mdausa.org /) присуждается PG. PG поддерживается старшим научным сообществом, спонсируемым Pfizer Australia (http://www.pfizer.com.au/sites/au/research_and_development/Pages/default.aspx). Институт сердца и диабета Baker IDI частично поддерживается Программой поддержки оперативной инфраструктуры правительства Виктории. Финансирующие организации не играли никакой роли в дизайне исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

    Конкурирующие интересы: PG является стипендиатом старшего научного сотрудника, спонсируемого Pfizer Australia.Эта награда была учреждена, чтобы помочь начинающим ученым разработать программу независимых некоммерческих исследований в австралийском университете или некоммерческом исследовательском институте. Спонсорство этой награды со стороны Pfizer Australia обеспечивает PG зарплату и средства для покрытия расходов на учреждение. Pfizer не участвует в исследованиях, проводимых PG, и не вносит в них вклад, а также не проверяет результаты этого исследования перед отправкой для публикации. Финансовое спонсорство этой независимой исследовательской стипендии со стороны Pfizer Australia не представляет собой конкурирующего интереса для авторов этой работы и не влияет на соблюдение авторами всех политик PLOS ONE в отношении обмена данными и материалами.

    Введение

    Рекомбинантные аденоассоциированные вирусные векторы (rAAV-векторы) были широко разработаны как средство доставки кассет экспрессии генов in vivo к различным постмитотическим типам клеток с конечной целью облегчения симптомов заболевания [1] . Способность векторов rAAV достигать сильной и продолжительной трансдукции неделящихся клеток без значительной патогенности или геномной интеграции также сделала их ценными инструментами для манипулирования и выяснения функции генов на животных моделях.С этой целью векторы rAAV показали себя многообещающими в качестве перспективных вмешательств для понимания и лечения различных состояний, влияющих на нервно-мышечную, сердечную, дыхательную, печеночную, кровеносную и сенсорную системы [2].

    В экспериментах с использованием векторов rAAV для управления функцией генов репортерные гены, такие как β-галактозидаза [3], [4], [5], щелочная фосфатаза плаценты человека (hPLAP) [4], [6], [7], люцифераза [8], [9] и зеленый флуоресцентный белок (GFP) [10], [11] обычно используются в качестве экспериментального контроля.Векторы, несущие репортерные гены, которые обычно не экспрессируются в мышцах, позволяют измерить эффективность трансдукции, а также эффекты экспрессии трансгена, зависящие от дозы и времени, при одновременном контроле влияния введения эквивалентной дозы рекомбинантных вирусных векторов, используемых в экспериментальных условиях. Однако экспрессия таких ненативных генов в скелетных мышцах может изменять клеточную функцию и, следовательно, усложнять интерпретацию эффектов, связанных с доставкой экспериментального вектора, если он используется в качестве экспериментального контроля.

    Предыдущие исследования наблюдали воспалительные реакции в скелетных мышцах млекопитающих после введения rAAV-векторов, несущих кассеты экспрессии, кодирующие ненативные гены, такие как бактериальная β-галактозидаза [3], [12], [13], [14] и фактор свертывания крови IX [ 15]. Однако эффекты, по-видимому, различаются в зависимости от гена, так как мы и другие успешно использовали векторы rAAV для трансдукции скелетных мышц млекопитающих с генами, кодирующими белки, которые обычно не экспрессируются у видов-хозяев [16], [17].Другие группы сообщили, что чрезмерная экспрессия нативных белков может вызывать токсические эффекты в скелетных мышцах, предполагая, что уровень экспрессии трансгена может определять, вызваны ли разрушение клеток и локальное воспаление нарушением функций в клетке-мишени, в качестве альтернативы. активация иммуногенных ответов [18]. Учитывая, что рекомбинантные векторы AAV способны обеспечивать высокоэффективную доставку кассет экспрессии генов и что векторы на основе репортерных генов обычно используются в качестве «нефункциональных» контролей при экспериментальном манипулировании мышцами, важно установить, могут ли обычно используемые репортерные трансгены вызывают собственные эффекты, когда выражаются в скелетных мышцах.

    Чтобы ответить на этот вопрос, мы исследовали мышцы задних конечностей мышей после введения rAAV-векторов псевдотипа-6, несущих кассеты экспрессии, кодирующие репортерные гены hPLAP и GFP. Мы сообщаем здесь, что местное введение вектора rAAV6: hPLAP в скелетные мышцы вызывает зависящее от дозы и времени рекрутирование провоспалительных макрофагов, а также значительное повреждение скелетных мышц. Эти эффекты не зависели от типа промотора, поскольку векторы, несущие кассеты экспрессии с конститутивными промоторами CMV и мышечно-специфическими промоторами CK6, вызывали аналогичный клеточный ответ при сопоставлении по общему количеству генома.Наблюдаемые вредные эффекты были связаны с уровнем экспрессии конкретного трансгена, поскольку мы наблюдали, что увеличенная доза векторов rAAV6, несущих кассету экспрессии GFP, требовалась для получения аналогичного воспалительного / дегенеративного ответа. Более того, при всех испытанных дозах вектора rAAV-векторы, несущие кассету экспрессии без генов, хорошо переносились. Мы пришли к выводу, что исследования, использующие конструкции репортерного гена в качестве экспериментального контроля при изучении скелетных мышц млекопитающих, должны учитывать влияние репортерного гена на функцию клеток-мишеней, прежде чем интерпретировать эффекты экспериментального вмешательства по сравнению с мышцами, трансдуцированными репортерным геном.

    Фиг. 1. Внутримышечное введение векторов rAAV6: CMV-hPLAP вызывает воспаление и повреждение скелетных мышц в зависимости от дозы и времени.

    (a) В ТА-мышцы мышей инъецировали 1 × 10 8 , 1 × 10 9 или 1 × 10 10 геномов контрольного вектора или rAA6: CMV-hPLAP и исследовали в течение 14 дней. после. ТА-мышцы рассекали и окрашивали гематоксилином и эозином для общей морфологии или NBT / BCIP для определения экспрессии плацентарной щелочной фосфатазы человека (пурпурный).Звездочки обозначают общие черты на серийных срезах, используемых для морфологии и активности hPLAP. (b) Анализ динамики мышц, исследованных через 7, 14, 21 и 28 дней после инъекции векторов rAAV6, показывает время пика индукции воспаления в ответ на rAAV: CMV-hPLAP по сравнению с безгенным вектором (rAAV6 : CMV-MCS) или rAAV6: Follistatin288.

    https://doi.org/10.1371/journal.pone.0051627.g001

    Методы

    Заявление об этике

    Все эксперименты с использованием животных проводились в соответствии с соответствующими кодексами практики по уходу и использованию животных в научных целях (Национальные институты здравоохранения, 1985 г., и Национальный совет здравоохранения и медицины Австралии, 2004 г.).Все протоколы экспериментов были одобрены Комитетом по этике животных отделения медицинских исследований и образования Альфреда (AMREP AEC). Все операции выполнялись при ингаляции изофлурана в медицинском кислороде, при этом соблюдались строгие протоколы, чтобы минимизировать боль и дискомфорт.

    Рисунок 2. Введение rAAV6: CMV-hPLAP приводит к повышенной экспрессии провоспалительных маркеров макрофагов и активации провоспалительного сигнального пути.

    (a) ТА-мышцы инъецировали указанными дозами rAAV6: CMV-hPLAP или rAAV6: контроль CMV-MCS.Через 14 дней после инъекции РНК экстрагировали из мышечной ткани и анализировали экспрессию EMR1 и ITGAX. *, p <0,05 по сравнению с контролем. (b) Экспрессию EMR, а также других маркеров воспаления, IL-1β, IL-6 и TNFα анализировали через 14, 21 и 28 дней после введения 1 × 10 9 геномов rAAV6: CMV-hPLAP. *, p <0,05 по сравнению с контролем. (c) Повышение экспрессии IL-6 также коррелирует с повышенным фосфорилированием Stat3. Фосфорилирование JNK и IKK-β также оценивали с помощью вестерн-блоттинга *, p <0.05 по сравнению с контролем. (d) Экспрессию генов MyoD и miR-206, а также уровни белка MEF-2 анализировали из ткани, собранной через 14 или 28 дней после введения вектора. *, p <0,05 по сравнению с контролем.

    https://doi.org/10.1371/journal.pone.0051627.g002

    Химические вещества и антитела

    Все антитела были получены от Cell Signaling Technology, за исключением GAPDH и MEF-2 (Санта-Крус). Экспрессию hPLAP исследовали на криосрезов с использованием раствора субстрата NBT / BCIP (Sigma FAST, Sigma).Другие химические реагенты были получены от Sigma, если не указано иное.

    Фигура 3. Замена rAAV6: CMV-hPLAP на мышечно-специфический промотор CK6 не улучшает эффекты векторно-опосредованной экспрессии hPLAP на повреждение и воспаление мышц. (A) Конструкции экспрессионных кассет, упакованных в rAAV6: CMV-hPLAP и rAAV6: Векторы CK6-hPLAP (b) Векторы инъецировали в ТА-мышцы мышей, и их эффекты исследовали через 14 или 28 дней, используя те же методы, что и на фигуре , фиг. 1 .

    Повреждение и клеточная инфильтрация не были очевидны в мышцах, исследованных через 14 дней после инъекции rAAV6: CK6-hPLAP, но были заметны через 28 дней после инъекции. (c) Экспрессию EMR, IL-6 и IL-1β оценивали через 14 и 28 дней после введения векторов rAAV6: CMV-MCS, rAAV6: CMV-hPLAP и rAAV6: CK6-hPLAP. *, p <0,05 по сравнению с контролем (d) Белок экстрагировали из мышц и определяли уровни фосфорилирования медиаторов воспаления Stat3, JNK и IKK-β с помощью Вестерн-блоттинга. *, р <0.05 по сравнению с контролем (e) Экспрессию MyoD и miR-206 исследовали в мышцах, собранных через 14 или 28 дней после введения векторов rAAV6: CMV-MCS, rAAV6: CMV-hPLAP и rAAV6: CK6-hPLAP. *, p <0,05 по сравнению с контролем.

    https://doi.org/10.1371/journal.pone.0051627.g003

    Клонирование и производство рекомбинантных аденоассоциированных вирусных векторов

    конструкций кДНК, кодирующих человеческий PLAP, гуманизированный Renilla GFP или человеческий фоллистатин-288, клонировали в плазмиду экспрессии AAV, состоящую из промотора / энхансера CMV или CK6 [19], [20] и области поли-A SV40, фланкированной концевыми повторами AAV2 [ 21], используя стандартные методы клонирования.Трансфекция этих плазмид упаковывающей плазмидой pDGM6 в клетки HEK293 генерировала вирусные векторы псевдотипа 6-го типа, которые собирали и очищали, как описано ранее [21]. Вкратце, клетки HEK293, суспендированные в среде Игла, модифицированной Дульбекко (DMEM, Life Technologies) с добавлением 10% фетальной бычьей сыворотки (Hyclone) и 1% пенициллина / стрептомицина (Life Technologies), высевали с плотностью 3,2-3,8 × 10 6 клетки на стерильных 10-см культуральных чашках (Corning), за 8-16 ч до трансфекции 10 мкг плазмиды с кассетой экспрессии AAV и 20 мкг упаковывающей / вспомогательной плазмиды pDGM6 с помощью метода преципитации фосфатом кальция для создания псевдотипа 6 векторов [21].Через 12 часов после трансфекции клетки начинали инкубировать в бессывороточной среде, а через 72 часа после трансфекции среду и клетки собирали и гомогенизировали с помощью микрофлюидизатора (Microfluidics Inc) перед осветлением 0,22 мкм (Millipore). Векторы выделяли из осветленного лизата с помощью аффинной хроматографии на аффинной колонке с гепарином (HiTrap, GE Life Sciences) и ультрацентрифугировали в течение ночи перед повторным суспендированием в стерильном физиологическом растворе Рингера. Препараты очищенных векторов количественно оценивали с помощью индивидуализированной количественной реакции на основе ПЦР, специфичной для последовательности (Applied Biosystems), состоящей из прямого праймера (ttttcactgcattctagttgtggtt), обратного праймера (catgctctagtcgaggtcgagat) и зонда (6FAM-actcatcaatgtatctNatcatQ-MGB).

    Фигура 4. Опосредованная вектором rAAV6 экспрессия GFP оказывает пониженное воспалительное действие в скелетных мышцах по сравнению с экспрессией hPLAP.

    (a) rAAV6: CMV-GFP или векторы rAAV6: CMV-MCS инъецировали в ТА-мышцы мышей в геномах 1 × 10 9 или 1 × 10 10 . Мышцы, исследованные через 14 и 28 дней после инъекции 1 × 10 9 rAAV6: векторные геномы CMV-GFP продемонстрировали сильную экспрессию трансгена без признаков клеточной инфильтрации или разрушения мышц.Однако воспаление было очевидным в мышцах, исследованных через 28 дней после приема 1 × 10 10 мкг rAAV6: CMV-GFP. (bc) Экспрессия EMR, ITGAX, IL-1β и IL-6 не различалась в мышцах, исследованных через 14 или 28 дней после приема 1 × 10 9 мкг rAAV6: CMV-GFP (по сравнению с мышцами, получавшими rAAV6: CMV- MCS), но был повышен в мышцах, исследованных через 14 или 28 дней после приема 1 × 10 10 мкг rAAV6: CMV-GFP. *, p <0,05 по сравнению с контролем.

    https://doi.org/10.1371 / journal.pone.0051627.g004

    Экспериментальные животные и хирургическая процедура

    Для локальной доставки вектора самцов мышей C57BL / 6 в возрасте ~ 8 недель подвергали глубокой анестезии и 1 × 10 8 , 1 × 10 9 или 1 × 10 10 геномов данного вектора в 30 мкл Хэнкса. Забуференный физиологический раствор (HBSS) вводили непосредственно в переднюю большеберцовую мышцу (TA), занимающую передний отдел нижней задней конечности, с помощью многоразового шприца, снабженного иглой 32 г (Hamilton).Для контрольных инъекций в мышцу контралатеральной конечности использовался вектор, лишенный функционального гена (обозначаемый как rAAV6: MCS). Для сбора ткани мышей гуманно умерщвляли с помощью шейного смещения, и мышцы ТА быстро вырезали, промокали насухо и взвешивали перед последующей обработкой.

    Гистохимическое окрашивание

    Свежесобранные мышцы помещали в криопротектор с оптимальной температурой резки (Tissue-Tek OCT, Sakura) и замораживали в охлаждаемом жидким азотом изопентане. Затем замороженные образцы подвергали криосрезу толщиной 10 мкм и окрашивали гематоксилином и эозином для изучения морфологии, как описано ранее [22].Срезы фиксировали в метаноле, промывали дистиллированной водой, погружали в раствор гематоксилина (Amber Scientific, Австралия) на 3 минуты, ополаскивали дистиллированной водой и водопроводной водой, инкубировали в водопроводной воде Скотта (Amber Scientific, Австралия) в течение 1 минуты. с последующим протеканием водопроводной воды в течение 2 минут, затем погружением в раствор эозина (Amber Scientific, Австралия) на 2 минуты и последующим переносом через увеличивающуюся концентрацию этанола перед погружением в ксилол и нанесением покрытия с добавкой DEPEX (BDH).Гистохимическое окрашивание на активность hPLAP проводили, как описано ранее [6]. Вкратце, срезы фиксировали 4% параформальдегидом, трижды промывали холодным фосфатно-солевым буфером (PBS), помещали в PBS при 65 ° C на 90 минут и промывали в PBS комнатной температуры. Излишки жидкости удаляли из секций, и раствор субстрата NBT / BCIP (Sigma) наносили на каждую секцию на 30 минут при комнатной температуре в темноте. Предметные стекла трижды промывали в PBS и покрывали монтажной средой Permount ™ (Fisher Scientific).

    QPCR в реальном времени

    Суммарная РНК была собрана из мгновенно замороженной ткани после гомогенизации в ледяном Тризоле (Invitrogen). 500–1000 нг РНК подвергали обратной транскрипции с использованием набора High Capacity RNA-to-cDNA (Applied Biosystems). кДНК впоследствии анализировали с помощью количественной ОТ-ПЦР с использованием целевых специфических зондов и наборов праймеров для EMR1, ITGAX, TNFα, IL-1β MyoD и IL-6 (Taqman ™, Applied Biosystems) вместе с зондом и праймерами для 18S, используемыми для стандартизации кДНК. концентрации.Для анализа miR-206 использовали реагенты Assay on Demand ™ (Applied Biosystems) в соответствии с инструкциями производителя. Данные были проанализированы с использованием метода анализа ΔΔCT и представлены как кратное изменение к контрольному значению 1.

    Вестерн-блоттинг

    мышц ТА гомогенизировали в буфере для лизиса на основе RIPA (Merck Millipore) с коктейлями, не содержащими ЭДТА, протеазой и ингибиторами фосфатазы (Complete ™ Tablets, Roche). После лизиса следовало центрифугирование при 13000 × g в течение 10 минут при 4 ° C, и образцы денатурировали в течение 5 минут при 95 ° C.Концентрацию белка определяли с использованием набора для анализа микробелков (Pierce, Thermo Scientific). Затем фракции белков разделяли с помощью SDS-PAGE с использованием предварительно отлитых 4–12% гелей Bis-Tris (Invitrogen), наносили на нитроцеллюлозные мембраны (Biorad) и инкубировали с соответствующими антителами в течение ночи. Все первичные антитела были приготовлены в разведениях 1–1000 в PBS-tween, содержащем 5% BSA, за исключением GAPDH (использованного при 1–5000). Мембраны промывали и инкубировали в соответствующей вторичной обмотке (используемой при 1-5000) в течение 1 часа при комнатной температуре.Затем были разработаны мембраны, как описано ранее [23]. Количественная оценка меченых вестерн-блоттингов была проведена с использованием пиксельного анализа ImageJ (программное обеспечение NIH Image) [24], и данные нормализованы до контрольного значения 1. Денситометрические анализы вестерн-блоттинга представлены как плотность полосы, нормализованная к контролю загрузки, и являются репрезентативными. минимум трех независимых экспериментов.

    Статистический анализ

    T-критерий Стьюдента использовался для оценки различий в одной переменной между двумя группами.Односторонний дисперсионный анализ ANOVA использовался для оценки различий в нескольких группах, в то время как апостериорный тест Стьюдента-Ньюмана-Кеулса использовался для сравнения между группами. Данные представлены в виде среднего значения ± стандартная ошибка среднего.

    Результаты

    rAAV6: введение CMV-hPLAP вызывает воспаление в скелетных мышцах мышей в зависимости от дозы и времени

    hPLAP использовался в качестве репортерного гена в предыдущих исследованиях для определения эффективности трансдукции, а также в качестве экспериментального контроля при исследовании эффектов манипулирования интересующими генами с использованием векторно-опосредованной доставки генов.При трансдуцировании в ТА-мышцы мышей экспрессия белка из этого трансгена вызывает дозозависимое увеличение воспаления и повреждения мышц, которое коррелирует с повышением активности hPLAP через 14 дней после введения rAAV6: hPLAP (рис. 1а). Хотя при использовании самой низкой дозы вирусного генома, используемой здесь, воспалительного ответа не наблюдалось, местное введение 1 × 10 9 векторных геномов (или более высоких доз) было связано с явными признаками клеточной инфильтрации и повреждения тканей.Этот эффект также зависел от времени, поскольку воспаление и повреждение тканей, которые были очевидны через 14 дней после введения 1 × 10 9 векторных геномов, не наблюдались в мышцах, исследованных через 7 дней после доставки вектора (фиг. 1b). В мышцах, экспрессирующих высокие уровни hPLAP, при исследовании через 28 дней после введения rAAV6: hPLAP наблюдались многочисленные центральные ядра мышечных волокон, что свидетельствует о регенеративной реакции на предшествующую дегенерацию трансдуцированных мышечных волокон (см. Стрелки). Наблюдаемая клеточная инфильтрация и мышечная дегенерация были определены как продукт экспрессии hPLAP, поскольку экспрессия другого трансгена — человеческого фоллистатина-288 [17] после введения эквивалентной дозы вектора не вызвала воспалительной реакции и нарушения архитектуры ткани. .

    Опосредованная вектором rAAV экспрессия hPLAP способствует привлечению макрофагов и Т-клеток и активации воспалительных сигнальных каскадов

    Чтобы подтвердить, что экспрессия hPLAP в скелетных мышцах ТА мыши вызывает ответ, связанный с рекрутированием макрофагов, мы измерили экспрессию провоспалительных маркеров макрофагов в ответ на увеличивающиеся дозы введения вектора. Хотя введение 1 × 10 8 векторных геномов не повлияло на экспрессию EMR1 или ITGAX, введение 1 × 10 9 или более векторных геномов привело к заметному увеличению экспрессии EMR и ITGAX в лизатах, полученных из образцов мышц, исследованных после 14 лет. дней (рис.2а). Из исследованных временных точек экспрессия EMR достигла пика через 14 дней, а затем снизилась до 28 дней, когда не было существенной разницы по сравнению с мышцами ТА, которым инъецировали rAVA6: CMV-MCS (фиг. 2b).

    Затем мы исследовали других возбудителей воспаления, включая цитокины IL-1β, IL-6 и TNF-α, и обнаружили, что, как и в случае с EMR, их экспрессия была максимальной через 14 дней после введения rAAV6: CMV-hPLAP, а затем снизилась на 28 дней (рис. 2б). Чтобы еще раз подтвердить активацию провоспалительных путей, мы исследовали фосфорилирование Stat3, JNK и IKK-β.Лизаты мышц, которым инъецировали rAAV6: CMV-hPLAP, демонстрировали повышенное фосфорилирование Stat3, JNK и IKK-β (фиг. 2c). Повышение регуляции миогенных регуляторных факторов необходимо для облегчения дифференциации вновь формирующихся миофибрилл во время регенерации мышц, и поэтому их повышенная регуляция является маркером ремоделирования и восстановления мышц. Соответственно, мы также подтвердили, что воспалительная реакция, вызванная экспрессией hPLAP в мышцах, совпадала с регенерацией волокон скелетных мышц, что продемонстрировано повышенными уровнями MyoD на уровне гена и повышением MEF-2 на уровне белка.Эти изменения также совпали с индукцией микроРНК-206. Ранее было элегантно продемонстрировано, что эта сигнальная схема регулирует клеточную дифференцировку [25], [26] (Fig. 2d).

    Экспрессия hPLAP под контролем мышечного промотора также связана с дегенерацией мускулатуры мышей и воспалением

    Учитывая способность промотора CMV эффективно экспрессировать трансгены в различных типах клеток, из представленных здесь исследований неясно, действительно ли управляемый CMV rAAV6: hPLAP напрямую трансдуцирует и активирует резидентные воспалительные клетки в скелетных мышцах.Чтобы проверить эту гипотезу, мы ввели 10 9 геномов rAAV-векторов, несущих кассету экспрессии hPLAP, после замены промотора CMV на мышечно-специфический промотор CK6, который не экспрессируется в тканях, кроме скелетных мышц [20] (рис. 3а). ) и сравнили эффекты этого вектора с эффектами, наблюдаемыми после введения rAAV6: CMV-hPLAP (фиг. 3b). В то время как вредные эффекты rAAV6: CMV-hPLAP на морфологию ТА-мышцы повторялись через 14 дней после введения вектора, инъекция rAAV6: CK6-hPLAP, по-видимому, не влияла на архитектуру ТА скелетных мышц в тот же момент времени.Однако к 28 дню воспаление и разрушение тканей были очевидны в мышцах ТА, которым инъецировали rAAV6: CK6-hPLAP (фиг. 3b).

    Когда мы исследовали экспрессию генов макрофагов и маркеров воспаления, мы обнаружили, что инъекция векторов rAAV6: CMV-hPLAP оказала заметное влияние на индукцию экспрессии EMR, IL-6 и IL-1β через 14 дней, в то время как инъекция rAAV6: CK6- hPLAP этого не сделал. Однако через 28 дней после лечения, когда провоспалительная сигнатура уменьшилась в мышцах, которым вводили векторы rAAV6: CMV-hPLAP, определенное, хотя и уменьшенное увеличение этих маркеров наблюдалось в мышцах, которым вводили векторы rAAV6: CK6-hPLAP.Фосфорилирование медиаторов воспаления IKKβ, JNK и Stat3 также увеличивалось в мышцах, исследованных через 28 дней, но не через 14 дней после введения векторов rAAV6: CK6-hPLAP (фиг. 3d). Мы также подтвердили, что клеточное разрушение, наблюдаемое после введения rAAV6: CK6-hPLAP, также совпадало с повышенной экспрессией регенеративных маркеров MyoD и микро-РНК-206 (рис. 3e). Изменения экспрессии MyoD и miR-206 были сопоставимы между мышцами, обработанными rAAV6: CK6-hPLAP и rAAV6-CMV: hPLAP.Эти данные демонстрируют, что хотя экспрессия hPLAP под контролем промотора / энхансера CK6 ограничена скелетными мышцами, уровень экспрессии трансгена, обеспечиваемый мышцами, также может приводить к воспалению и повреждению мышечных волокон.

    Опосредованная вектором rAAV6 экспрессия GFP оказывает пониженный воспалительный эффект в скелетных мышцах по сравнению с экспрессией hPLAP

    В качестве средства для идентификации более подходящего репортерного трансгена мы попытались изучить эффект экспрессии гуманизированного GFP Renilla в мышцах путем введения 1 × 10 9 или 1 × 10 10 векторов rAAV6: CMV-GFP в TA. мышцы мышей.Когда rAAV6: CMV-GFP вводили в дозе 1 × 10 9 векторных геномов, мы обнаружили, что значительная экспрессия GFP достигалась в трансдуцированных мышцах задних конечностей, но что архитектура мышей сохранялась в течение как минимум 28 дней ( Рис. 4а). Только когда мы увеличили дозу rAAV6: CMV-GFP, вводимую в десять раз (1 × 10 10 геномов), наблюдалось значительное повреждение мышц, сопровождающееся клеточной инфильтрацией. При последующих оценках маркеров инфильтрации и воспаления макрофагов мы не обнаружили значительной индукции маркеров, когда мышцы получили 1 × 10 9 векторных геномов rAAV6: CMV-GFP (в отличие от эффектов, отмеченных при использовании эквивалентной дозы rAAV6: CMV-hPLAP. ).Однако, когда rAAV6: CMV-GFP вводили в дозе 1 × 10 10 векторных геномов, значительное увеличение макрофагов и маркеров воспаления было обнаружено через 28 дней (фиг. 4b). Эти данные показывают, что использование GFP может быть лучшей альтернативой hPLAP в качестве репортерного гена для экспрессии в скелетных мышцах, но эту векторную дозу и величину последующей экспрессии трансгена необходимо принимать во внимание при планировании эксперимента.

    Обсуждение

    При использовании рекомбинантных векторов AAV для манипулирования экспрессией генов в скелетной мускулатуре параллельные когорты часто обрабатывают векторами, несущими репортерные гены, в качестве экспериментальных контролей.Хотя репортерные гены можно рассматривать как «нефункциональные» по сравнению с интересующими экспериментальными конструкциями, важно учитывать эффекты репортерного гена при рассмотрении дизайна эксперимента и относительной интерпретации экспериментальных вмешательств. В этом исследовании мы показали, что гены, обычно доставляемые в репортерных конструкциях, могут способствовать дозозависимому воспалению и разрушению скелетной мускулатуры мышей. Полученные данные демонстрируют, что выбор репортерного гена и степени экспрессии являются важными факторами при планировании исследований для изучения влияния векторного вмешательства на клеточные процессы, участвующие в адаптации мышц, а также на морфологические атрибуты экспериментально манипулируемых мышц.

    Внутримышечное воспаление и дегенерация трансдуцированной мускулатуры могут быть вызваны примированием иммунной системы для устранения введенного антигена, такого как белки капсида, содержащие частицу вирусного вектора [27]. Предварительное воздействие на людей и других млекопитающих аденоассоциированных вирусов дикого типа или rAAV-векторов может повысить чувствительность иммунной системы хозяина к реакции против вводимых впоследствии векторов [28], [29]. Однако мы и другие широко продемонстрировали, что реципиенты, ранее не подвергавшиеся воздействию, обычно переносят внутримышечное введение векторов rAAV без признаков клеточного повреждения [17].Рекомбинантные векторы AAV обычно проявляют очень мало доказательств неблагоприятного воздействия на клетки-мишени, поскольку в них отсутствуют кодирующие области их генома дикого типа, они происходят от вирусов дикого типа, которые не связаны со специфическими патологиями человека, и обычно не способствуют модификации клеток-хозяев. геном. Наши данные согласуются с предыдущими результатами, так как мы смогли напрямую вводить векторы rAAV, лишенные функционального гена (rAAV6: CMV-MCS), в мускулатуру мышей, не вызывая последующего клеточного повреждения и воспаления.

    Трансдукция скелетных мышц конструкциями, экспрессирующими ненативные белки, также может способствовать иммунной реакции и сопутствующему повреждению тканей, как это было продемонстрировано после внутримышечного введения векторов rAAV [30], [31]. Однако этот ответ, по-видимому, варьируется в зависимости от экспрессируемого гена, поскольку многие другие исследования (включая наши собственные) использовали векторы rAAV для успешной трансдукции мускулатуры млекопитающих с помощью конструкций, кодирующих ненативные гены, без наблюдения за последующим повреждением тканей и воспалением [ 4], [16], [32].В наших исследованиях, представленных здесь, мы продемонстрировали аналогичную хорошо переносимую экспрессию ненативных трансгенов с помощью векторов rAAV для экспрессии человеческого фоллистатина-288 в скелетных мышцах мышей. Мы также достигли устойчивой экспрессии зеленого флуоресцентного белка, производного Renilla, в скелетных мышцах мышей без признаков клеточной дегенерации и воспаления, в зависимости от используемой дозы вектора.

    Наши результаты положительной корреляции между дозой вектора rAAV6: hPLAP и частотой воспаления и клеточного повреждения в мышцах мышей (и аналогичная корреляция, хотя и требующая более высоких доз для rAAV6: GFP) предполагают, что определенные генные продукты могут нарушать клеточную функцию, если экспрессируются на достаточно высокие уровни.В поддержку этой идеи сообщалось, что дозозависимые токсические эффекты могут наблюдаться даже после экспрессии мышечно-специфичных трансгенов в скелетных мышцах с помощью векторных подходов [18]. В некоторых исследованиях использовались тканеспецифические промоторные / энхансерные элементы для снижения токсичности трансдуцированной мускулатуры и сведения к минимуму возможности непреднамеренной экспрессии трансгена в антиген-продуцирующих клетках [19], [33], [34], тогда как в других сообщалось, что использование мышечной -специфические промоторы не предотвращают вредную реакцию [3], [35].Воспалительный ответ, который мы наблюдали в мышцах, трансдуцированных кассетами экспрессии hPLAP, был менее выражен в ранние моменты времени, когда промотор CMV был заменен мышечным промотором, производным от креатинкиназы (CK6) [19]. Уменьшение воспаления, индуцированного hPLAP под действием мышечного промотора, коррелировало со снижением уровней экспрессии hPLAP в мышцах TA в этот момент времени. Однако значительное повреждение все еще наблюдалось в мышцах, обработанных rAAV6: CK6-hPLAP в более поздние моменты времени, одновременно с прогрессивным увеличением экспрессии hPLAP.Наши результаты согласуются с предыдущими исследованиями, в которых воспалительная реакция на трансдукцию мускулатуры млекопитающих не устранялась, а замедлялась путем замены промотора, специфичного для мышц, вместо промотора CMV [3], [35]. Промотор CK6 значительно менее эффективен в своей способности управлять экспрессией репортерного гена в скелетных мышцах, чем промотор CMV [20]. Следовательно, в наших исследованиях накопление hPLAP до токсичных уровней будет происходить медленнее в мышцах, трансдуцированных конструкциями CK6-hPLAP, по сравнению с мышцами, получающими конструкции CMV-hPLAP.

    Чтобы определить, может ли альтернативный выбор репортерного гена обеспечить более практичную трансдукцию мускулатуры млекопитающих без воспаления, мы вводили векторы rAAV6: CMV-GFP в мышцы мышей. В отличие от результатов, полученных после введения rAAV6: CMV-hPLAP, мы наблюдали, что трансдукция мышц с эквивалентной дозой 1 × 10 9 vg rAAV6: CMV-GFP вызвала широко распространенную экспрессию трансгена без признаков клеточной дегенерации или воспалительного ответа.Однако увеличение дозы инъецированного rAAV6: CMV-GFP до 1 × 10 10 vg впоследствии приводило к повреждению мышц, рекрутированию макрофагов и активации воспалительного сигнального пути. Наши данные показывают, что GFP следует предпочесть hPLAP в качестве репортерного гена для экспрессии в скелетных мышцах мышей, но все же следует учитывать дозу используемого вектора и соответствующий уровень вызываемой экспрессии трансгена. В некоторых случаях, когда оправдано введение более высоких доз вектора, мы предлагаем, что предпочтительно использовать вектор с удаленным геном в качестве экспериментального контроля, поскольку эта конфигурация, по-видимому, не вызывает клеточной дегенерации и воспаления, наблюдаемых после трансдукции мышц конечностей с помощью более высокие дозы векторов, несущих вышеупомянутые репортерные гены.

    Таким образом, наши исследования подчеркивают потенциальные вредные эффекты обычно используемых репортерных генов при экспрессии в скелетных мышцах млекопитающих. И hPLAP, и GFP обладают способностью вызывать устойчивое рекрутирование макрофагов и активацию воспалительного пути в мышцах мышей, и эти эффекты, по-видимому, связаны с уровнем экспрессии трансгена, а не с нагрузкой векторных частиц. Важно отметить, что способность вызывать дегенерацию и воспаление трансдуцированных мышц также, по-видимому, варьируется в зависимости от репортерных генов.Следовательно, возможно, что другие репортерные гены (например, варианты щелочной фосфатазы [36], [37], другие флуоресцентные белки и конструкции люциферазы) могут обладать способностью вызывать аналогичные вредные эффекты в скелетных мышцах, если они экспрессируются на достаточно высоких уровнях. Эти результаты обеспечивают важное понимание потенциальных побочных эффектов экспрессии обычно используемых репортерных генов в скелетных мышцах млекопитающих и подчеркивают важность определения их потенциального воздействия на трансдуцированные ткани перед использованием в качестве экспериментального контроля для исследований in vivo .

    Благодарности

    Авторы выражают благодарность доктору С.Д. Хаушка, за конструкцию промотора CK6 и отзывы о подготовке рукописи, д-р J.S. Чемберлен для конструкций pAAV: CMV-hPLAP и pAAV: CMV-GFP, клеток HEK293 и отзывы о подготовке рукописи, д-р D.W. Рассела за конструкцию pDGM6, доктора Дж. М. Аллена за совет по производству векторов (все исследователи из Вашингтонского университета). Авторы также благодарят доктора Г.И. Ланкастер и профессор М.А.Феббрайо (Div.Metabolism, Baker IDI Heart and Diabetes Institute) за предоставление доступа к своим запасам меченных FAM зондов / праймеров для EMR1, ITGAX, TNFα и IL-1β.

    Вклад авторов

    Задумал и спроектировал эксперименты: CEW PG. Проведены эксперименты: CEW CB HQ. Проанализированы данные: CEW CB HQ PG. Написал статью: CEW PG. Получено разрешение на использование плазмид и линий клеток и других реагентов: PG.

    Ссылки

    1. 1. Wu Z, Asokan A, Samulski RJ (2006) Серотипы аденоассоциированных вирусов: набор векторных инструментов для генной терапии человека.Мол Тер 14: 316–327.
    2. 2. Mingozzi F, High KA (2011) Терапевтический перенос генов in vivo для генетических заболеваний с использованием AAV: прогресс и проблемы. Нат Рев Генет 12: 341–355.
    3. 3. Юаса К., Сакамото М., Миягоэ-Сузуки Ю., Танучи А., Ямамото Х. и др. (2002) Опосредованный аденоассоциированным вирусом перенос гена в скелетные мышцы с дефицитом дистрофина вызывает усиленный иммунный ответ против продукта трансгена. Джин Тер 9: 1576–1588.
    4. 4.Грегоревич П., Бланкиншип М.Дж., Аллен Дж.М., Кроуфорд Р.В., Мёз Л. и др. (2004) Системная доставка генов к поперечно-полосатым мышцам с использованием аденоассоциированных вирусных векторов. Нат Мед 10: 828–834.
    5. 5. Ghosh A, Yue Y, Duan D (2011) Эффективное восстановление трансгена с помощью гибридных двойных векторов AAV, несущих минимизированные мостиковые последовательности. Hum Gene Ther 22: 77–83.
    6. 6. Грегоревич П., Шульц Б. Р., Аллен Дж. М., Холлдорсон Дж. Б., Бланкиншип М. Дж. И др. (2009) Оценка методологий доставки в сосуды для усиления передачи гена, опосредованного rAAV6, в поперечнополосатую мускулатуру собак.Мол Тер 17: 1427–1433.
    7. 7. Halbert CL, Allen JM, Miller AD (2001) Векторы аденоассоциированного вируса типа 6 (AAV6) опосредуют эффективную трансдукцию эпителиальных клеток дыхательных путей в легких мыши по сравнению с векторами AAV2. J Virol 75: 6615–6624.
    8. 8. Гонин П., Арандел Л., Ван Виттенберг Л., Марэ Т., Перес Н. и др. (2005) Бедренная внутриартериальная инъекция: инструмент для доставки и оценки рекомбинантных конструкций AAV в целую заднюю конечность грызунов. J Gene Med 7: 782–791.
    9. 9. Цяо С., Чжан В., Юань З., Шин Дж. Х., Ли Дж. И др. (2010) Мутации капсидного тирозина-фенилаланина серотипа 6 аденоассоциированного вируса улучшают перенос генов в скелетные мышцы. Hum Gene Ther 21: 1343–1348.
    10. 10. Ren C, Kumar S, Shaw DR, Ponnazhagan S (2005) Геномная стабильность самокомплементарного аденоассоциированного вируса 2 на ранних стадиях трансдукции в мышцах мыши in vivo. Hum Gene Ther 16: 1047–1057.
    11. 11. Субраманиан IV, Фернандес BC, Робинсон Т., Кенинг Дж., Лапара К.С. и др.(2009) AAV-2-опосредованная экспрессия IGF-1 в скелетных миобластах стимулирует ангиогенез и выживание клеток. J. Cardiovasc Transl Res 2: 81–92.
    12. 12. Брокштедт Д.Г., Подсакофф Г.М., Фонг Л., Курцман Г., Мюллер-Рухгольц В. и др. (1999) Индукция иммунитета к антигенам, экспрессируемым рекомбинантным аденоассоциированным вирусом, зависит от пути введения. Clin Immunol 92: 67–75.
    13. 13. Sarukhan A, Camugli S, Gjata B, von Boehmer H, Danos O, et al. (2001) Успешное вмешательство в клеточные иммунные ответы на иммуногенные белки, кодируемые рекомбинантными вирусными векторами.Дж. Вирол 75: 269–277.
    14. 14. Manning WC, Paliard X, Zhou S, Pat Bland M, Lee AY и др. (1997) Генетическая иммунизация аденоассоциированными вирусными векторами, экспрессирующими гликопротеины В и D. вируса простого герпеса 2 типа. J Virol. 71: 7960–7962.
    15. 15. Сонг С., Морган М., Эллис Т., Пуарье А., Чеснут К. и др. (1998) Устойчивая секреция альфа-1-антитрипсина человека мышцами мышей, трансдуцированных аденоассоциированными вирусными векторами. Proc Natl Acad Sci U S A 95: 14384–14388.
    16. 16. Грегоревич П., Аллен Дж. М., Минами Э., Бланкиншип М. Дж., Харагути М. и др. (2006) rAAV6-микродистрофин сохраняет мышечную функцию и увеличивает продолжительность жизни у мышей с тяжелой дистрофией. Nat Med 12: 787–789.
    17. 17. Winbanks CE, Weeks KL, Thomson RE, Sepulveda PV, Beyer C и др .. (2012) Гипертрофия скелетных мышц, опосредованная фоллистатином, регулируется Smad3 и mTOR независимо от миостатина. J Cell Biol.
    18. 18. Дрессман Д., Араиши К., Имамура М., Сасаока Т., Лю Л.А. и др.(2002) Доставка альфа- и бета-саркогликана рекомбинантным аденоассоциированным вирусом: эффективное восстановление мышц, но различная токсичность. Hum Gene Ther 13: 1631–1646.
    19. 19. Хаузер М.А., Робинсон А., Хартиган-О’Коннор Д., Уильямс-Грегори Д.А., Бускин Дж. Н. и др. (2000) Анализ регуляторных элементов мышечной креатинкиназы в рекомбинантных аденовирусных векторах. Мол Тер 2: 16–25.
    20. 20. Salva MZ, Himeda CL, Tai PW, Nishiuchi E, Gregorevic P и др. (2007) Дизайн тканеспецифических регуляторных кассет для высокоуровневой rAAV-опосредованной экспрессии в скелетных и сердечных мышцах.Мол Тер 15: 320–329.
    21. 21. Blankinship MJ, Gregorevic P, Allen JM, Harper SQ, Harper H и др. (2004) Эффективная трансдукция скелетных мышц с использованием векторов на основе аденоассоциированного вируса серотипа 6. Mol Ther 10: 671–678.
    22. 22. Рафаэль Дж. А., Кокс Г. А., Коррадо К., Юнг Д., Кэмпбелл К. П. и др. (1996) Принудительная экспрессия конструкций делеции дистрофина выявляет структурно-функциональные корреляции. J Cell Biol 134: 93–102.
    23. 23. Winbanks CE, Wang B, Beyer C, Koh P, White L, et al.(2011) TGF-beta регулирует miR-206 и miR-29, чтобы контролировать миогенную дифференцировку посредством регуляции HDAC4. J Biol Chem 286: 13805–13814.
    24. 24. Расбанд WS (1997–2012) ImageJ. Бетесда, Мэриленд, США: Национальные институты здравоохранения США. Доступно: http://imagej.nih.gov/ij/, 1997–22012.
    25. 25. Rosenberg MI, Georges SA, Asawachaicharn A, Analau E, Tapscott SJ (2006) MyoD ингибирует экспрессию Fstl1 и Utrn, индуцируя транскрипцию miR-206. J Cell Biol 175: 77–85.
    26. 26. Rao PK, Kumar RM, Farkhondeh M, Baskerville S, Lodish HF (2006) Миогенные факторы, которые регулируют экспрессию специфичных для мышц микроРНК. Proc Natl Acad Sci U S A 103: 8721–8726.
    27. 27. Vandenberghe LH, Wilson JM (2007) AAV как иммуноген. Curr Gene Ther 7: 325–333.
    28. 28. Ван З., Сторб Р., Ли Д., Кушмерик М. Дж., Чу Б. и др. (2010) Иммунные ответы на AAV в мышцах собак, отслеживаемые с помощью клеточных анализов и неинвазивной визуализации.Мол Тер 18: 617–624.
    29. 29. Ван З., Аллен Дж. М., Ридделл С. Р., Грегоревич П., Сторб Р. и др. (2007) Иммунитет к переносу гена, опосредованному аденоассоциированным вирусом, в модели мышечной дистрофии Дюшенна у собак, полученной случайным образом. Hum Gene Ther 18: 18–26.
    30. 30. Охшима С., Шин Дж. Х., Юаса К., Нишияма А., Кира Дж. И др. (2009) Эффективность трансдукции и иммунный ответ, связанный с введением вектора AAV8 в скелетные мышцы собаки. Мол Тер 17: 73–80.
    31. 31.Юаса К., Йошимура М., Урасава Н., Охшима С., Хауэлл Дж. М. и др. (2007) Инъекция рекомбинантного AAV серотипа 2 в скелетные мышцы собак вызывает сильный иммунный ответ против трансгенных продуктов. Джин Тер 14: 1249–1260.
    32. 32. Harper SQ, Hauser MA, DelloRusso C, Duan D, Crawford RW и др. (2002) Модульная гибкость дистрофина: значение для генной терапии мышечной дистрофии Дюшенна. Nat Med 8: 253–261.
    33. 33. Хартиган-О’Коннор Д., Кирк С.Дж., Кроуфорд Р., Мул Дж.Дж., Чемберлен Дж.С. (2001) Уклонение от иммунитета за счет экспрессии специфичных для мышц гена в дистрофических мышцах.Мол Тер 4: 525–533.
    34. 34. Кордье Л., Гао Г.П., Хак А.А., Макнелли Э.М., Уилсон Дж. М. и др. (2001) Мышечно-специфические промоторы могут быть необходимы для опосредованного аденоассоциированным вирусом переноса генов при лечении мышечных дистрофий. Hum Gene Ther 12: 205–215.
    35. 35. Wang L, Dobrzynski E, Schlachterman A, Cao O, Herzog RW (2005) Системная доставка белка путем переноса мышечного гена ограничена местным иммунным ответом. Кровь 105: 4226–4234.
    36. 36. Ван М., Орсини С., Казанова Д., Миллан Дж. Л., Махфуди А. и др.(2001) MUSEAP, новый репортерный ген для изучения долговременной экспрессии генов у иммунокомпетентных мышей. Ген 279: 99–108.
    37. 37. Бартоли М., Попиот Дж., Гойенвалле А., Перес Н., Гарсия Л. и др. (2006) Неинвазивный мониторинг переноса терапевтических генов на животных моделях мышечных дистрофий.

    Добавить комментарий

    Ваш адрес email не будет опубликован. Обязательные поля помечены *